Dataset Viewer
Auto-converted to Parquet Duplicate
Search is not available for this dataset
id
int64
9.83M
10.1M
design
stringlengths
1
255
sequence
stringlengths
107
107
secondary_structure
stringlengths
107
107
reactivity
sequencelengths
107
107
errors_reactivity
sequencelengths
107
107
signal_to_noise_reactivity
float64
-0.1
17.2
deg_pH10
sequencelengths
107
107
errors_deg_pH10
sequencelengths
107
107
signal_to_noise_deg_pH10
float64
-0.06
15.4
deg_50C
sequencelengths
107
107
errors_deg_50C
sequencelengths
107
107
signal_to_noise_deg_50C
float64
-0.05
13.5
deg_Mg_pH10
sequencelengths
107
107
errors_deg_Mg_pH10
sequencelengths
107
107
signal_to_noise_deg_Mg_pH10
float64
-0.06
15.4
deg_Mg_50C
sequencelengths
107
107
errors_deg_Mg_50C
sequencelengths
107
107
signal_to_noise_deg_Mg_50C
float64
-0.05
13.5
SN_filter
bool
2 classes
9,830,366
testing
GGAAAUUUGCUGAUCUUCAGCAUCAGGAAUACUGAUGUCCUUUGCCCGCCAGCGGCAAGGCAGGAUAACCUACCAUUCGUGGUAGGAAAAGAAACAACAACAACAAC
.......((((((...))))))((((.....))))((((((..(((.(((...)))..))))))))).(((((((....))))))).....................
[ 0.4167, 1.5941, 1.2359, 1.0576, 1.2434, 1.0954, 0.8250000000000001, 0.3783, 0.4143, 0.1404, 0.0419, 0.3875, 1.6687, 0.5745, 0.9262, 1.2846, 0.6504, 0.1718, 0.25420000000000004, 0.011600000000000001, 0.1852, 0.1772, 0.12350000000000001, 0.0572, 0.0056, 0.168200000000...
[ 0.1689, 0.2323, 0.193, 0.17420000000000002, 0.18780000000000002, 0.1718, 0.1426, 0.10160000000000001, 0.1048, 0.07060000000000001, 0.0437, 0.1056, 0.18960000000000002, 0.1097, 0.1322, 0.1512, 0.1033, 0.0641, 0.07050000000000001, 0.042, 0.062400000000000004, 0.0623, 0.0523...
5.326
[ 1.5966, 2.6482, 1.3761, 0.6159, 1.1937, 1.2161, 0.9439000000000001, 0.4545, 0.27340000000000003, 0.42260000000000003, 0.023200000000000002, 0.1063, 0.6064, 0.0785, 0.9068, 2.3626, 0.2726, 0.1706, 0.0344, 0.0018000000000000002, 0.9443, 0.5469, 0.18150000000000002, 0.3643...
[ 0.3058, 0.3294, 0.233, 0.1693, 0.23390000000000002, 0.2277, 0.18630000000000002, 0.1368, 0.1183, 0.1321, 0.0483, 0.11280000000000001, 0.20850000000000002, 0.09040000000000001, 0.1797, 0.2641, 0.1004, 0.09630000000000001, 0.064, 0.07590000000000001, 0.1617, 0.1316, 0.0852,...
4.198
[ 0.7885000000000001, 1.93, 2.0423, 0.9917, 1.2132, 0.5876, 1.1684, 0.34450000000000003, 0.2142, 0.1955, 0.028800000000000003, 0.3106, 0.6875, 0.1075, 0.37210000000000004, 1.9022000000000001, 0.21810000000000002, 0.30810000000000004, 0.10310000000000001, 0.057300000000000004, 0...
[ 0.2773, 0.328, 0.3048, 0.22260000000000002, 0.2551, 0.1996, 0.22440000000000002, 0.1383, 0.1212, 0.1149, 0.058800000000000005, 0.1471, 0.22360000000000002, 0.1019, 0.1481, 0.2677, 0.10450000000000001, 0.1246, 0.08600000000000001, 0.0902, 0.1356, 0.1265, 0.1040000000000000...
3.746
[ 1.5966, 2.6482, 1.3761, 0.6159, 1.1937, 1.2161, 0.9439000000000001, 0.4545, 0.27340000000000003, 0.42260000000000003, 0.023200000000000002, 0.1063, 0.6064, 0.0785, 0.9068, 2.3626, 0.2726, 0.1706, 0.0344, 0.0018000000000000002, 0.9443, 0.5469, 0.18150000000000002, 0.3643...
[ 0.3058, 0.3294, 0.233, 0.1693, 0.23390000000000002, 0.2277, 0.18630000000000002, 0.1368, 0.1183, 0.1321, 0.0483, 0.11280000000000001, 0.20850000000000002, 0.09040000000000001, 0.1797, 0.2641, 0.1004, 0.09630000000000001, 0.064, 0.07590000000000001, 0.1617, 0.1316, 0.0852,...
4.198
[ 0.7885000000000001, 1.93, 2.0423, 0.9917, 1.2132, 0.5876, 1.1684, 0.34450000000000003, 0.2142, 0.1955, 0.028800000000000003, 0.3106, 0.6875, 0.1075, 0.37210000000000004, 1.9022000000000001, 0.21810000000000002, 0.30810000000000004, 0.10310000000000001, 0.057300000000000004, 0...
[ 0.2773, 0.328, 0.3048, 0.22260000000000002, 0.2551, 0.1996, 0.22440000000000002, 0.1383, 0.1212, 0.1149, 0.058800000000000005, 0.1471, 0.22360000000000002, 0.1019, 0.1481, 0.2677, 0.10450000000000001, 0.1246, 0.08600000000000001, 0.0902, 0.1356, 0.1265, 0.1040000000000000...
3.746
true
9,832,027
whbob-RYO1
GGAAAACGUACGUACGUGAAGACGUACGUACGUGAAAGAACGUACGUACGUAAAAACGUACGUACGUACUAUAUAUUCGUAUAUAGAAAAGAAACAACAACAACAAC
.....((((((((((((....((((((((((((......))))))))))))....)))))))))))).(((((((....))))))).....................
[ 0.561, 2.0749, 2.0628, 1.4636, 1.0189, 0.07250000000000001, 0.21530000000000002, -0.0291, 0.08460000000000001, 0.0356, 0.035500000000000004, 0.0708, 0.2793, 0, 0, 0.24150000000000002, 0.20980000000000001, 0.26930000000000004, 0.46080000000000004, 0.1308, 0.8215, 0.1241, 0...
[ 0.3635, 0.5666, 0.4959, 0.4187, 0.3463, 0.1479, 0.19820000000000002, 0.09240000000000001, 0.18580000000000002, 0.12490000000000001, 0.1247, 0.14450000000000002, 0.21150000000000002, 0.0756, 0.0756, 0.20020000000000002, 0.20420000000000002, 0.20400000000000001, 0.2417, 0.1605, ...
2.035
[ 1.8013000000000001, 4.0226, 2.0108, 2.1225, 1.7074, 0.131, 0.2604, 0.3245, 0.5112, 0.1268, 0.2523, 0.43710000000000004, 0.7973, 0, 0.244, 0.1217, -0.062400000000000004, 0.4813, 0.35810000000000003, 0.3552, 0.5657, 0.1159, 0.23070000000000002, 0, -0.0086, 0.1148, 0...
[ 0.7522000000000001, 1.0128, 0.6839000000000001, 0.6943, 0.6081, 0.26930000000000004, 0.3205, 0.37420000000000003, 0.4384, 0.26130000000000003, 0.3108, 0.3639, 0.4398, 0.1376, 0.301, 0.25120000000000003, 0.17420000000000002, 0.3664, 0.332, 0.3295, 0.46290000000000003, 0.24, ...
1.453
[ 0.48040000000000005, 1.5609, 0.9087000000000001, 0.48360000000000003, 1.3819000000000001, 0.6787000000000001, 0.1689, 0.1978, 0.14250000000000002, 0.166, 0, 0, 0.3292, 0.3264, 0, 0.3236, -0.053700000000000005, 0.7923, 0.3143, 0.6185, 0.5442, 0, 0, 0, -0.10650000000000...
[ 0.5533, 0.8322, 0.5906, 0.5013000000000001, 0.6635, 0.5119, 0.3422, 0.3886, 0.393, 0.33630000000000004, 0.17450000000000002, 0.17450000000000002, 0.401, 0.3976, 0.1718, 0.39430000000000004, 0.1942, 0.5156000000000001, 0.38320000000000004, 0.467, 0.516, 0.1607, 0.1607, 0...
0.987
[ 1.8013000000000001, 4.0226, 2.0108, 2.1225, 1.7074, 0.131, 0.2604, 0.3245, 0.5112, 0.1268, 0.2523, 0.43710000000000004, 0.7973, 0, 0.244, 0.1217, -0.062400000000000004, 0.4813, 0.35810000000000003, 0.3552, 0.5657, 0.1159, 0.23070000000000002, 0, -0.0086, 0.1148, 0...
[ 0.7522000000000001, 1.0128, 0.6839000000000001, 0.6943, 0.6081, 0.26930000000000004, 0.3205, 0.37420000000000003, 0.4384, 0.26130000000000003, 0.3108, 0.3639, 0.4398, 0.1376, 0.301, 0.25120000000000003, 0.17420000000000002, 0.3664, 0.332, 0.3295, 0.46290000000000003, 0.24, ...
1.453
[ 0.48040000000000005, 1.5609, 0.9087000000000001, 0.48360000000000003, 1.3819000000000001, 0.6787000000000001, 0.1689, 0.1978, 0.14250000000000002, 0.166, 0, 0, 0.3292, 0.3264, 0, 0.3236, -0.053700000000000005, 0.7923, 0.3143, 0.6185, 0.5442, 0, 0, 0, -0.10650000000000...
[ 0.5533, 0.8322, 0.5906, 0.5013000000000001, 0.6635, 0.5119, 0.3422, 0.3886, 0.393, 0.33630000000000004, 0.17450000000000002, 0.17450000000000002, 0.401, 0.3976, 0.1718, 0.39430000000000004, 0.1942, 0.5156000000000001, 0.38320000000000004, 0.467, 0.516, 0.1607, 0.1607, 0...
0.987
true
9,832,100
DE1
GGAAAGCUAGAAGGUGGGAGCGUAGCUCUCACGGCUCGAAAGAGCGUCGUCGAAACGACGGCUCUAGCGCGAUGCUUCGGCAUCGCAAAAGAAACAACAACAACAAC
.....((((((..((((((((...)))))))).((((....))))(((((((...)))))))))))))(((((((....))))))).....................
[ 0.9936, 2.0523, 1.9282000000000001, 1.1317, 0.4525, 0.06620000000000001, 0.0201, 0.1516, 0.0068000000000000005, 0.0794, 0.7459, 0.30770000000000003, 0.6196, 0.1777, -0.0063, 0.0055000000000000005, 0.0118, 0.011, 0.0118, 0.0173, 0.1047, 2.3912, 1.4308, 0.65, 0.12010000...
[ 0.1806, 0.2048, 0.18330000000000002, 0.14200000000000002, 0.0932, 0.043300000000000005, 0.0344, 0.0629, 0.0291, 0.056600000000000004, 0.1144, 0.07970000000000001, 0.1022, 0.058100000000000006, 0.0173, 0.0268, 0.0245, 0.0323, 0.0244, 0.031100000000000003, 0.0511, 0.171, 0....
5.76
[ 2.1372, 2.7669, 1.5435, 0.7534000000000001, 0.6376000000000001, 0.40390000000000004, 0.5115000000000001, 0.0742, 0.35000000000000003, 0.4722, 0.3114, 0.5239, 0.5163, 0.1971, 0.1436, 0.0257, 0, 0.0317, 0.07830000000000001, 0.0646, -0.0076, 0.37470000000000003, 0.1461, 0....
[ 0.3141, 0.2964, 0.2146, 0.1655, 0.1447, 0.11470000000000001, 0.129, 0.0794, 0.1111, 0.1356, 0.12190000000000001, 0.1363, 0.13470000000000001, 0.08320000000000001, 0.08, 0.0546, 0.0239, 0.06280000000000001, 0.060200000000000004, 0.0646, 0.0509, 0.1269, 0.08360000000000001,...
3.597
[ 0.9757, 1.4531, 1.3308, 0.9947, 0.7188, 0.42360000000000003, 0.46230000000000004, 0.4873, 0.45020000000000004, 0.6102000000000001, 0.7918000000000001, 0.48160000000000003, 0.3738, 0.1772, 0.013600000000000001, -0.0117, 0.0253, 0.0523, 0, 0.0261, 0.06470000000000001, 0.25570...
[ 0.2807, 0.2671, 0.2358, 0.2107, 0.17650000000000002, 0.1381, 0.1448, 0.1509, 0.14120000000000002, 0.1665, 0.1822, 0.14850000000000002, 0.13570000000000002, 0.093, 0.0557, 0.0344, 0.0519, 0.0745, 0.027800000000000002, 0.060700000000000004, 0.0775, 0.1263, 0.149800000000000...
3.202
[ 2.1372, 2.7669, 1.5435, 0.7534000000000001, 0.6376000000000001, 0.40390000000000004, 0.5115000000000001, 0.0742, 0.35000000000000003, 0.4722, 0.3114, 0.5239, 0.5163, 0.1971, 0.1436, 0.0257, 0, 0.0317, 0.07830000000000001, 0.0646, -0.0076, 0.37470000000000003, 0.1461, 0....
[ 0.3141, 0.2964, 0.2146, 0.1655, 0.1447, 0.11470000000000001, 0.129, 0.0794, 0.1111, 0.1356, 0.12190000000000001, 0.1363, 0.13470000000000001, 0.08320000000000001, 0.08, 0.0546, 0.0239, 0.06280000000000001, 0.060200000000000004, 0.0646, 0.0509, 0.1269, 0.08360000000000001,...
3.597
[ 0.9757, 1.4531, 1.3308, 0.9947, 0.7188, 0.42360000000000003, 0.46230000000000004, 0.4873, 0.45020000000000004, 0.6102000000000001, 0.7918000000000001, 0.48160000000000003, 0.3738, 0.1772, 0.013600000000000001, -0.0117, 0.0253, 0.0523, 0, 0.0261, 0.06470000000000001, 0.25570...
[ 0.2807, 0.2671, 0.2358, 0.2107, 0.17650000000000002, 0.1381, 0.1448, 0.1509, 0.14120000000000002, 0.1665, 0.1822, 0.14850000000000002, 0.13570000000000002, 0.093, 0.0557, 0.0344, 0.0519, 0.0745, 0.027800000000000002, 0.060700000000000004, 0.0775, 0.1263, 0.149800000000000...
3.202
true
9,832,110
Prox 1-1B to TS - Control
GGAAACGCGCUGGUGCGAGCGGCUGCGGCGAAAGCCGCCGAAAGGCGCAGUCGCUCGCGCCAGCGCGAGGUGCACUUCGGUGCACCAAAAGAAACAACAACAACAAC
.....((((((((((((((((((((((((....)))(((....)))))))))))))))))))))))).(((((((....))))))).....................
[ 2.8185000000000002, 1.74, 2.5836, 1.6942, 0.33340000000000003, 0, 0.3281, 0.323, 0, 0, 0, 0, 0, 0, 0, 0.318, 0.31320000000000003, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, -0.1829, 0.6079, 1.1483, 0, 0.5586, 0.2756, 0.272, 0, 0, 0, 0, 0.2684, 0....
[ 1.6312, 1.4359, 1.3582, 1.1119, 0.6918000000000001, 0.381, 0.6816, 0.6717000000000001, 0.372, 0.372, 0.372, 0.372, 0.372, 0.372, 0.372, 0.6622, 0.653, 0.3635, 0.3635, 0.3635, 0.3635, 0.3635, 0.3635, 0.3635, 0.3635, 0.3635, 0.3635, 0.3635, 0.48160000000000003, ...
0.373
[ 1.8813, 0.4248, 1.1873, 0, 0.5858, 0, 1.1416, 0, 0, 0, 0, 0, 0, 0, 0.5636, 0, 0, 0.5566, 0.5497000000000001, 0, 0, 0, 0, 0, 0, 0, 0.543, 0, -0.394, 0, 0.5364, 0, 0.53, 0, 1.0354, 0, 0, 0.5118, 0, 0, 0, 0.506, 0.5003000000000001, 0...
[ 1.7604, 1.7576, 1.4873, 0.7145, 1.2373, 0.708, 1.4343000000000001, 0.6956, 0.6956, 0.6956, 0.6956, 0.6956, 0.6956, 0.6956, 1.1952, 0.6897, 0.6897, 1.182, 1.169, 0.6784, 0.6784, 0.6784, 0.6784, 0.6784, 0.6784, 0.6784, 1.1564, 0.6729, 0.9570000000000001, 0.670...
0.17
[ 2.8059, 0.2283, 1.3223, 0.4358, 0, 0.8522000000000001, 0, 0, 0.8336, 0, 0, 0, 0, 0, 0, 0, 0.8159000000000001, 0, 0, 0, 0, 0, 0.7989, 0, 0, 0, 0.7826000000000001, 0, -0.33940000000000003, 1.5038, 0, 0, 0, 0.7375, 0.7235, 0, 0, 0.71010000000000...
[ 2.579, 2.0044, 1.9909000000000001, 1.5267, 0.9364, 1.7384, 0.9184, 0.9184, 1.7021, 0.9012, 0.9012, 0.9012, 0.9012, 0.9012, 0.9012, 0.9012, 1.6673, 0.8848, 0.8848, 0.8848, 0.8848, 0.8848, 1.6341, 0.8692000000000001, 0.8692000000000001, 0.8692000000000001, 1.6022, ...
0.236
[ 1.8813, 0.4248, 1.1873, 0, 0.5858, 0, 1.1416, 0, 0, 0, 0, 0, 0, 0, 0.5636, 0, 0, 0.5566, 0.5497000000000001, 0, 0, 0, 0, 0, 0, 0, 0.543, 0, -0.394, 0, 0.5364, 0, 0.53, 0, 1.0354, 0, 0, 0.5118, 0, 0, 0, 0.506, 0.5003000000000001, 0...
[ 1.7604, 1.7576, 1.4873, 0.7145, 1.2373, 0.708, 1.4343000000000001, 0.6956, 0.6956, 0.6956, 0.6956, 0.6956, 0.6956, 0.6956, 1.1952, 0.6897, 0.6897, 1.182, 1.169, 0.6784, 0.6784, 0.6784, 0.6784, 0.6784, 0.6784, 0.6784, 1.1564, 0.6729, 0.9570000000000001, 0.670...
0.17
[ 2.8059, 0.2283, 1.3223, 0.4358, 0, 0.8522000000000001, 0, 0, 0.8336, 0, 0, 0, 0, 0, 0, 0, 0.8159000000000001, 0, 0, 0, 0, 0, 0.7989, 0, 0, 0, 0.7826000000000001, 0, -0.33940000000000003, 1.5038, 0, 0, 0, 0.7375, 0.7235, 0, 0, 0.71010000000000...
[ 2.579, 2.0044, 1.9909000000000001, 1.5267, 0.9364, 1.7384, 0.9184, 0.9184, 1.7021, 0.9012, 0.9012, 0.9012, 0.9012, 0.9012, 0.9012, 0.9012, 1.6673, 0.8848, 0.8848, 0.8848, 0.8848, 0.8848, 1.6341, 0.8692000000000001, 0.8692000000000001, 0.8692000000000001, 1.6022, ...
0.236
false
9,832,120
Prox 1-1B to TS – 1bp
GGAAACGCGCUGGUGCGAGCGGCUGCGGCGAAAGCCGCCGAAAGGCGGAGUCGCUCGCGCCAGCGCGAGCUGCACUUCGGUGCAGCAAAAGAAACAACAACAACAAC
.....(((((((((((((((((((.((((....)))(((....)))).))))))))))))))))))).(((((((....))))))).....................
[ 0.0935, 2.247, 2.0968, 0.7227, 0.2851, -0.0631, 0.0786, 0.1406, 0, 0, 0, 0, 0.27740000000000004, 0, 0, 0.2738, 0.136, 0, 0, 0.0724, 0, 0, 0, 0.2667, 0.6459, 0, 0.8038000000000001, 0.123, 0.2432, 1.9789, 2.1469, 0.1462, 0.5985, 0.46140000000000003, ...
[ 0.4052, 0.8342, 0.713, 0.47200000000000003, 0.34990000000000004, 0.1904, 0.3098, 0.2882, 0.154, 0.154, 0.154, 0.154, 0.3408, 0.15230000000000002, 0.15230000000000002, 0.33640000000000003, 0.2791, 0.14980000000000002, 0.14980000000000002, 0.2979, 0.1489, 0.1489, 0.1489, ...
1.186
[ 1.6957, 2.1926, 0.7030000000000001, 1.1416, 0.6746, 0.5286000000000001, 0.0849, 0, 0, 0, 0, 0.21930000000000002, 0.21830000000000002, 0.2172, 0.21610000000000001, 0, 0.2151, 0, 0.2141, 0.2889, 0, 0, 0, 0.6271, 0.2081, 0.4123, 0.6748000000000001, 0.4011, 0, 0...
[ 0.997, 1.1227, 0.6546000000000001, 0.7514000000000001, 0.6293000000000001, 0.6635, 0.5175000000000001, 0.25880000000000003, 0.25880000000000003, 0.25880000000000003, 0.25880000000000003, 0.4591, 0.4571, 0.455, 0.453, 0.2551, 0.451, 0.25420000000000004, 0.4491, 0.5788, 0.2514,...
0.633
[ 1.2537, 2.4687, 1.8194000000000001, 0.8217, 0.5401, 0.1511, -0.11670000000000001, 0, 0.26630000000000004, 0, 0.2645, 0, 0, 0, 0.2627, 0, 0, 0.2609, 0, 0.1427, 0, 0, 1.0091, 0, 0, 0.2506, 0.3788, 0.24580000000000002, 0.7235, 1.1691, 1.0189, 1.3148, 0.31...
[ 1.0279, 1.2728, 1.0005, 0.7575000000000001, 0.6625, 0.5852, 0.3556, 0.29250000000000004, 0.5452, 0.2908, 0.5417000000000001, 0.2891, 0.2891, 0.2891, 0.5381, 0.2874, 0.2874, 0.5346000000000001, 0.2858, 0.5681, 0.28400000000000003, 0.28400000000000003, 0.7658, 0.2778, 0...
0.681
[ 1.6957, 2.1926, 0.7030000000000001, 1.1416, 0.6746, 0.5286000000000001, 0.0849, 0, 0, 0, 0, 0.21930000000000002, 0.21830000000000002, 0.2172, 0.21610000000000001, 0, 0.2151, 0, 0.2141, 0.2889, 0, 0, 0, 0.6271, 0.2081, 0.4123, 0.6748000000000001, 0.4011, 0, 0...
[ 0.997, 1.1227, 0.6546000000000001, 0.7514000000000001, 0.6293000000000001, 0.6635, 0.5175000000000001, 0.25880000000000003, 0.25880000000000003, 0.25880000000000003, 0.25880000000000003, 0.4591, 0.4571, 0.455, 0.453, 0.2551, 0.451, 0.25420000000000004, 0.4491, 0.5788, 0.2514,...
0.633
[ 1.2537, 2.4687, 1.8194000000000001, 0.8217, 0.5401, 0.1511, -0.11670000000000001, 0, 0.26630000000000004, 0, 0.2645, 0, 0, 0, 0.2627, 0, 0, 0.2609, 0, 0.1427, 0, 0, 1.0091, 0, 0, 0.2506, 0.3788, 0.24580000000000002, 0.7235, 1.1691, 1.0189, 1.3148, 0.31...
[ 1.0279, 1.2728, 1.0005, 0.7575000000000001, 0.6625, 0.5852, 0.3556, 0.29250000000000004, 0.5452, 0.2908, 0.5417000000000001, 0.2891, 0.2891, 0.2891, 0.5381, 0.2874, 0.2874, 0.5346000000000001, 0.2858, 0.5681, 0.28400000000000003, 0.28400000000000003, 0.7658, 0.2778, 0...
0.681
false
9,832,122
roll 1
GGAAACUCAGUCCUCUCUGUAUCAGAGAGGACUGAGAGCACACGCAGCUCUAAUGAGCUGCGUGUGCACAUAUAUUUCGAUAUAUGAAAAGAAACAACAACAACAAC
.....((((((((((((((...)))))))))))))).(((((((((((((....))))))))))))).(((((((....))))))).....................
[ 6.8895, 6.3596, 0, 1.4763, 0, 0, 0, 0, 0, 0, 0, 1.3779000000000001, 0, 0, 0, 0, 0, 0, 3.4448, 5.7872, 5.0106, 1.1811, 0, 0, 0, 0, 0, 0, 0, 0, 0.5741, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1.0878, 4.96...
[ 6.2917, 4.7927, 1.6578, 2.9898000000000002, 1.5493000000000001, 1.5493000000000001, 1.5493000000000001, 1.5493000000000001, 1.5493000000000001, 1.5493000000000001, 1.5493000000000001, 2.7956, 1.4558, 1.4558, 1.4558, 1.4558, 1.4558, 1.4558, 3.1721, 3.0505, 2.4434, 1.5011, ...
0.48
[ 5.8075, 1.8552, 3.4249, 1.649, 1.5901, 1.5353, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1.4841, 0, 1.4363, 0, 1.3914, 1.3492, 0, 0, 1.3095, 0, 0, 0, 0, 0, 1.2721, 0, 0, 1.2368000000000001, 0, 0, 0, 1.2033, 0, 1.1717, 0, 0, 1.141...
[ 5.3847, 3.8458, 4.2563, 3.4498, 3.3374, 3.2331, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 3.136, 1.7963, 3.0455, 1.7569000000000001, 2.961, 2.8819, 1.6865, 1.6865, 2.8077, 1.6549, 1.6549, 1.6549...
0.296
[ 5.4782, 2.5565, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2.3967, 0, 0, 0, 0, 2.2557, 0, 2.1304, 0, 0, 2.0183, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 3.6521, 0, 4.7934, 1.5339, 0, 0...
[ 6.6699, 5.1867, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 4.872, 2.5502000000000002, 2.5502000000000002, 2.5502000000000002, 2.5502000000000002, 4.5948, 2.4182, 4.349, 2.3018, 2.3018, 4.1296, 2.1984, 2.1984, 2.1984, 2.1984, ...
0.148
[ 5.8075, 1.8552, 3.4249, 1.649, 1.5901, 1.5353, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1.4841, 0, 1.4363, 0, 1.3914, 1.3492, 0, 0, 1.3095, 0, 0, 0, 0, 0, 1.2721, 0, 0, 1.2368000000000001, 0, 0, 0, 1.2033, 0, 1.1717, 0, 0, 1.141...
[ 5.3847, 3.8458, 4.2563, 3.4498, 3.3374, 3.2331, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 1.8388, 3.136, 1.7963, 3.0455, 1.7569000000000001, 2.961, 2.8819, 1.6865, 1.6865, 2.8077, 1.6549, 1.6549, 1.6549...
0.296
[ 5.4782, 2.5565, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2.3967, 0, 0, 0, 0, 2.2557, 0, 2.1304, 0, 0, 2.0183, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 3.6521, 0, 4.7934, 1.5339, 0, 0...
[ 6.6699, 5.1867, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 2.7009, 4.872, 2.5502000000000002, 2.5502000000000002, 2.5502000000000002, 2.5502000000000002, 4.5948, 2.4182, 4.349, 2.3018, 2.3018, 4.1296, 2.1984, 2.1984, 2.1984, 2.1984, ...
0.148
false
9,832,126
Prox 1-1B to TS – 2bp
GGAAACGCGCUGGUGCGAGCGGCGGCGGCGAAAGCCGCCGAAAGGCGCGGUCGCUCGCGCCAGCGCGACGUGCACUUCGGUGCACGAAAAGAAACAACAACAACAAC
.....((((((((((((((((((.(((((....)))(((....))))).)))))))))))))))))).(((((((....))))))).....................
[ 0.7971, 3.2451, 1.346, 0.8268000000000001, 0.2963, 0, 0.0766, 0.0758, 0, 0, 0, 0, 0, 0, 0, 0, 0.145, 0.4262, 0, 0, 0, 0.4176, 0, 0, 0.1383, 0, 0.1373, 0, 0.201, 0.2676, 1.0175, 0.2513, 0.9586, 0.11910000000000001, 0, 0.1184, 0.1178, 0, 0, ...
[ 0.6846, 0.9528000000000001, 0.6617000000000001, 0.5078, 0.36460000000000004, 0.1642, 0.32630000000000003, 0.3242, 0.1621, 0.1621, 0.1621, 0.1621, 0.1621, 0.1621, 0.1621, 0.1621, 0.2985, 0.39440000000000003, 0.1585, 0.1585, 0.1585, 0.38670000000000004, 0.1559, 0.1559, ...
1.08
[ 1.2084, 3.9164, 0.43710000000000004, 0.5858, 0.5782, 0, 0.1353, 0.4157, 0, 0.2818, 0, 0, 0, 0, 0, 0.1405, 0.14, 0, 0, 0, 0.2783, 0.2765, 1.0794, 0.2682, 0, 0.2666, 0, 0, -0.1509, 0.7857000000000001, 0.2604, 0.7677, 0, 0.506, 0, 0, 0, 0.2515, ...
[ 1.1633, 1.5107, 0.85, 0.7234, 0.7145, 0.3269, 0.6499, 0.7487, 0.3215, 0.5836, 0.3199, 0.3199, 0.3199, 0.3199, 0.3199, 0.5029, 0.5014000000000001, 0.3184, 0.3184, 0.3184, 0.5768, 0.5735, 0.8236, 0.5574, 0.308, 0.5543, 0.30660000000000004, 0.30660000000000004, 0...
0.723
[ 0.5477000000000001, 0.7852, 0.2556, 0, 0.5113, 0, -0.13090000000000002, -0.13040000000000002, 0, 0, 0, 0, 0.254, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.2523, 0, 0, 0, 0, -0.13, 0.2506, 0.7375, 0, 0.24430000000000002, 0, 0.2427, 0, 0, 0, 0, 0.479...
[ 0.8594, 0.8959, 0.7013, 0.29050000000000004, 0.631, 0.2874, 0.3659, 0.3653, 0.28700000000000003, 0.28700000000000003, 0.28700000000000003, 0.28700000000000003, 0.5244, 0.28550000000000003, 0.28550000000000003, 0.28550000000000003, 0.28550000000000003, 0.28550000000000003, 0.28550...
0.46
[ 1.2084, 3.9164, 0.43710000000000004, 0.5858, 0.5782, 0, 0.1353, 0.4157, 0, 0.2818, 0, 0, 0, 0, 0, 0.1405, 0.14, 0, 0, 0, 0.2783, 0.2765, 1.0794, 0.2682, 0, 0.2666, 0, 0, -0.1509, 0.7857000000000001, 0.2604, 0.7677, 0, 0.506, 0, 0, 0, 0.2515, ...
[ 1.1633, 1.5107, 0.85, 0.7234, 0.7145, 0.3269, 0.6499, 0.7487, 0.3215, 0.5836, 0.3199, 0.3199, 0.3199, 0.3199, 0.3199, 0.5029, 0.5014000000000001, 0.3184, 0.3184, 0.3184, 0.5768, 0.5735, 0.8236, 0.5574, 0.308, 0.5543, 0.30660000000000004, 0.30660000000000004, 0...
0.723
[ 0.5477000000000001, 0.7852, 0.2556, 0, 0.5113, 0, -0.13090000000000002, -0.13040000000000002, 0, 0, 0, 0, 0.254, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.2523, 0, 0, 0, 0, -0.13, 0.2506, 0.7375, 0, 0.24430000000000002, 0, 0.2427, 0, 0, 0, 0, 0.479...
[ 0.8594, 0.8959, 0.7013, 0.29050000000000004, 0.631, 0.2874, 0.3659, 0.3653, 0.28700000000000003, 0.28700000000000003, 0.28700000000000003, 0.28700000000000003, 0.5244, 0.28550000000000003, 0.28550000000000003, 0.28550000000000003, 0.28550000000000003, 0.28550000000000003, 0.28550...
0.46
false
9,832,129
Prox 1-1B to TS – 3bp
GGAAACGCGCUGGUGCGAGCGGGUGCGGCGAAAGCCGCCGAAAGGCGCAGUCGCUCGCGCCAGCGCGACCUGCACUUCGGUGCAGGAAAAGAAACAACAACAACAAC
.....(((((((((((((((((.((((((....)))(((....)))))).))))))))))))))))).(((((((....))))))).....................
[ 0.4884, 1.9668, 1.4194, 0.3108, 0.7489, 0.5822, 0, 0, -0.0792, 0.14450000000000002, 0, 0, 0, 0, 0, 0, 0.14350000000000002, 0.2831, 0, 0, -0.0789, 0.1406, 0.41340000000000005, 0.4053, 0, 0, -0.0786, 0.2667, 0, 0.26330000000000003, 1.0021, 0.6079, 0.1209...
[ 0.5425, 0.7952, 0.6634, 0.3835, 0.4912, 0.44380000000000003, 0.1658, 0.1658, 0.2151, 0.2997, 0.1648, 0.1648, 0.1648, 0.1648, 0.1648, 0.1648, 0.2978, 0.3508, 0.1622, 0.1622, 0.212, 0.2921, 0.3846, 0.3774, 0.1564, 0.1564, 0.2073, 0.33140000000000003, 0.154800000...
0.918
[ 3.1661, 3.0019, 0.8349000000000001, 0.4975, 0.2474, 0.7299, 0.242, 0.4788, -0.1706, 0, 0, 0.2381, 0, 0, 0, 0, 0, 0.2368, 0, 0.2356, -0.1699, 0, 0.4662, 0.23190000000000002, 0.23070000000000002, 0.2295, 0.28500000000000003, 0.226, 0.22490000000000002, 0, 0....
[ 1.2897, 1.2559, 0.8287, 0.6244000000000001, 0.5235000000000001, 0.6864, 0.5134000000000001, 0.6027, 0.4168, 0.2939, 0.2939, 0.5058, 0.2929, 0.2929, 0.2929, 0.2929, 0.2929, 0.5034000000000001, 0.2919, 0.5011, 0.41350000000000003, 0.29050000000000004, 0.5879, 0.4939, 0....
0.49
[ 1.0618, 1.982, 0.5971000000000001, 0.3687, 0, 0.7235, 0.18, 0.5326000000000001, -0.1469, 0, 0, 0, 0, 0.3518, 0, 0.3486, 0, 0, 0, 0, -0.1464, 0, 1.0181, 0.6669, 0, 0, 0.18480000000000002, 0, 0, 0.32780000000000004, 0, 0, 0.6445000000000001, 0, 0, ...
[ 1.1425, 1.3576, 0.9460000000000001, 0.7521, 0.3971, 0.8858, 0.6321, 0.8036000000000001, 0.46090000000000003, 0.38430000000000003, 0.38430000000000003, 0.38430000000000003, 0.38430000000000003, 0.7188, 0.38130000000000003, 0.7125, 0.3783, 0.3783, 0.3783, 0.3783, 0.455200000000...
0.423
[ 3.1661, 3.0019, 0.8349000000000001, 0.4975, 0.2474, 0.7299, 0.242, 0.4788, -0.1706, 0, 0, 0.2381, 0, 0, 0, 0, 0, 0.2368, 0, 0.2356, -0.1699, 0, 0.4662, 0.23190000000000002, 0.23070000000000002, 0.2295, 0.28500000000000003, 0.226, 0.22490000000000002, 0, 0....
[ 1.2897, 1.2559, 0.8287, 0.6244000000000001, 0.5235000000000001, 0.6864, 0.5134000000000001, 0.6027, 0.4168, 0.2939, 0.2939, 0.5058, 0.2929, 0.2929, 0.2929, 0.2929, 0.2929, 0.5034000000000001, 0.2919, 0.5011, 0.41350000000000003, 0.29050000000000004, 0.5879, 0.4939, 0....
0.49
[ 1.0618, 1.982, 0.5971000000000001, 0.3687, 0, 0.7235, 0.18, 0.5326000000000001, -0.1469, 0, 0, 0, 0, 0.3518, 0, 0.3486, 0, 0, 0, 0, -0.1464, 0, 1.0181, 0.6669, 0, 0, 0.18480000000000002, 0, 0, 0.32780000000000004, 0, 0, 0.6445000000000001, 0, 0, ...
[ 1.1425, 1.3576, 0.9460000000000001, 0.7521, 0.3971, 0.8858, 0.6321, 0.8036000000000001, 0.46090000000000003, 0.38430000000000003, 0.38430000000000003, 0.38430000000000003, 0.38430000000000003, 0.7188, 0.38130000000000003, 0.7125, 0.3783, 0.3783, 0.3783, 0.3783, 0.455200000000...
0.423
false
9,832,134
Prox 1-1B to TS – 4bp from TS
GGAAACGCGCUGGUGCGAGCGGCUGCGGCGAAAGCCGCCGAAAGGCGCAGGCGCUCGCGCCAGCGCGAGGAGCACUUCGGUGCUCCAAAAGAAACAACAACAACAAC
.....((((((((((((((((.(((((((....)))(((....))))))).)))))))))))))))).(((((((....))))))).....................
[ 1.2966, 1.8455000000000001, 1.0439, 0.8027000000000001, 0.3937, 0.38630000000000003, 0, 1.0975, 0, 0.35950000000000004, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1.0249, 0, 0, 0, 0, 0.3361, 0, -0.1752, 0.3307, 0.6409, 0, 0.9186000000000001, 0, 0, 0, -0....
[ 1.3917, 1.4856, 1.0921, 0.9849, 0.807, 0.7926000000000001, 0.4248, 1.0149, 0.4062, 0.7403000000000001, 0.4005, 0.4005, 0.4005, 0.4005, 0.4005, 0.4005, 0.4005, 0.4005, 0.4005, 0.4005, 0.4005, 0.9499000000000001, 0.3846, 0.3846, 0.3846, 0.3846, 0.6950000000000001, ...
0.355
[ 6.2441, 0.1665, 0.9087000000000001, 2.5687, 0, 0, 0, 0, 0, 0, 0, 0.8401000000000001, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.8245, 0, 0, 0.8095, 0, -0.3773, 0.7951, 0, 0, 0, 0, 0, 0.7811, -0.37420000000000003, 0, 0, 1.5093, 0.7421, 0.7299,...
[ 3.5394, 2.0702, 1.8567, 2.37, 0.937, 0.937, 0.937, 0.937, 0.937, 0.937, 0.937, 1.7227000000000001, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 1.6924000000000001, 0.9081, 0.9081, 1.6632, 0.8945000000000001, 1.1067, ...
0.191
[ -0.3335, 0.32780000000000004, 2.7391, 1.7431, 0, 0, 0.8522000000000001, 0, 0, 0, 0, 0, 0.8336, 0, 0, 0.8159000000000001, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.7989, 0.7826000000000001, -0.325, 0, 2.2124, 0.7235, 0, 0, 0, 0, -0.32220000000000004, 0,...
[ 1.2096, 2.1198, 2.5159, 2.1294, 0.9311, 0.9311, 1.7356, 0.913, 0.913, 0.913, 0.913, 0.913, 1.6992, 0.8958, 0.8958, 1.6644, 0.8793000000000001, 0.8793000000000001, 0.8793000000000001, 0.8793000000000001, 0.8793000000000001, 0.8793000000000001, 0.8793000000000001, 0.87930...
0.25
[ 6.2441, 0.1665, 0.9087000000000001, 2.5687, 0, 0, 0, 0, 0, 0, 0, 0.8401000000000001, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.8245, 0, 0, 0.8095, 0, -0.3773, 0.7951, 0, 0, 0, 0, 0, 0.7811, -0.37420000000000003, 0, 0, 1.5093, 0.7421, 0.7299,...
[ 3.5394, 2.0702, 1.8567, 2.37, 0.937, 0.937, 0.937, 0.937, 0.937, 0.937, 0.937, 1.7227000000000001, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 0.9222, 1.6924000000000001, 0.9081, 0.9081, 1.6632, 0.8945000000000001, 1.1067, ...
0.191
[ -0.3335, 0.32780000000000004, 2.7391, 1.7431, 0, 0, 0.8522000000000001, 0, 0, 0, 0, 0, 0.8336, 0, 0, 0.8159000000000001, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.7989, 0.7826000000000001, -0.325, 0, 2.2124, 0.7235, 0, 0, 0, 0, -0.32220000000000004, 0,...
[ 1.2096, 2.1198, 2.5159, 2.1294, 0.9311, 0.9311, 1.7356, 0.913, 0.913, 0.913, 0.913, 0.913, 1.6992, 0.8958, 0.8958, 1.6644, 0.8793000000000001, 0.8793000000000001, 0.8793000000000001, 0.8793000000000001, 0.8793000000000001, 0.8793000000000001, 0.8793000000000001, 0.87930...
0.25
false
9,832,157
Prox 2 1-1Bs to TS – 2&4bp
GGAAACGCGCUGGUGCGAGCGGCGGCGGCGAAAGCCGCCGAAAGGCGCGGGCGCUCGCGCCAGCGCGACGAGCACUUCGGUGCUCGAAAAGAAACAACAACAACAAC
.....((((((((((((((((.(.(((((....)))(((....))))).).)))))))))))))))).(((((((....))))))).....................
[ -0.13, 2.419, 0.8159000000000001, 0.2684, 0.265, 0.1333, 0.2584, 0, 0, 0.25520000000000004, 0, 0, 0, 0, 0, 0, 0, 0.2521, 0, 0, 0.49210000000000004, 0.4807, 0, 0, 0, 0, 0, 0.4697, 0.23220000000000002, 0.45430000000000004, 2.0464, 0, 0.40130000000000005,...
[ 0.4146, 1.1616, 0.7542, 0.5522, 0.5455, 0.5829, 0.5324, 0.28850000000000003, 0.28850000000000003, 0.5262, 0.2856, 0.2856, 0.2856, 0.2856, 0.2856, 0.2856, 0.2856, 0.5202, 0.28290000000000004, 0.28290000000000004, 0.6077, 0.5943, 0.2725, 0.2725, 0.2725, 0.2725, 0.27...
0.757
[ 0.37470000000000003, 3.0535, 2.298, 2.6984, 0, -0.2765, 0, 0, 0, 0, 0, 0.5332, 0, 0.5269, 0, 0, 0, 0, 0, 0, 1.0295, 1.9679, 0.9627, 0.4762, 0, 0, 0, 0, 0, 0.4712, 0.4662, 0, 0.46140000000000003, 0, 0.4567, 0.452, 0, 0, 0, 1.316, 3.2529,...
[ 1.4243000000000001, 2.1015, 1.7458, 1.7685, 0.6072000000000001, 0.7728, 0.6064, 0.6064, 0.6064, 0.6064, 0.6064, 1.1017, 0.6007, 1.0895, 0.5951000000000001, 0.5951000000000001, 0.5951000000000001, 0.5951000000000001, 0.5951000000000001, 0.5951000000000001, 1.2731000000000001, ...
0.663
[ -0.2412, 0.7436, 0.9587, 0.9353, 1.7836, 2.2627, 0, 0.8159000000000001, 0, 0, 0, 0, 0.7989, 0.7826000000000001, 0, 0, 0, 0, 1.5038, 0, 0, 2.1304, 0, 0, 0, 0, 0, 0, 0, 2.0183, 1.2999, 0.6391, 0.6286, 0, 0, 0, 0, 0, 1.2174, 1.7431, 2.7005...
[ 1.1185, 2.0241, 1.9323000000000001, 1.8859000000000001, 2.1663, 2.3268, 0.867, 1.6491, 0.85, 0.85, 0.85, 0.85, 1.6155, 1.5832, 0.8180000000000001, 0.8180000000000001, 0.8180000000000001, 0.8180000000000001, 1.8308, 0.7887000000000001, 0.7887000000000001, 1.9547, 0.749, ...
0.534
[ 0.37470000000000003, 3.0535, 2.298, 2.6984, 0, -0.2765, 0, 0, 0, 0, 0, 0.5332, 0, 0.5269, 0, 0, 0, 0, 0, 0, 1.0295, 1.9679, 0.9627, 0.4762, 0, 0, 0, 0, 0, 0.4712, 0.4662, 0, 0.46140000000000003, 0, 0.4567, 0.452, 0, 0, 0, 1.316, 3.2529,...
[ 1.4243000000000001, 2.1015, 1.7458, 1.7685, 0.6072000000000001, 0.7728, 0.6064, 0.6064, 0.6064, 0.6064, 0.6064, 1.1017, 0.6007, 1.0895, 0.5951000000000001, 0.5951000000000001, 0.5951000000000001, 0.5951000000000001, 0.5951000000000001, 0.5951000000000001, 1.2731000000000001, ...
0.663
[ -0.2412, 0.7436, 0.9587, 0.9353, 1.7836, 2.2627, 0, 0.8159000000000001, 0, 0, 0, 0, 0.7989, 0.7826000000000001, 0, 0, 0, 0, 1.5038, 0, 0, 2.1304, 0, 0, 0, 0, 0, 0, 0, 2.0183, 1.2999, 0.6391, 0.6286, 0, 0, 0, 0, 0, 1.2174, 1.7431, 2.7005...
[ 1.1185, 2.0241, 1.9323000000000001, 1.8859000000000001, 2.1663, 2.3268, 0.867, 1.6491, 0.85, 0.85, 0.85, 0.85, 1.6155, 1.5832, 0.8180000000000001, 0.8180000000000001, 0.8180000000000001, 0.8180000000000001, 1.8308, 0.7887000000000001, 0.7887000000000001, 1.9547, 0.749, ...
0.534
false
9,832,340
Default title
GGAAACUCGGGCUCGAGCUCGGGCUCGAGCUCGAGCUCAGAAAAUCUGAGCUCGAGCUCGAGCCCGAGCAAUAUGUUCGCAUAUUGAAAAGAAACAACAACAACAAC
.....((((....))))((((((((((((((((((((((((...))))))))))))))))))))))))(((((((....))))))).....................
[ 0, -1.5899, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 20.6675, 8.2672, 0, 0, 0, 0, 3.4447, 0, 0, 0, 0, 0, 0, 2.9526, 0, 2.5835, 0, ...
[ 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 103344.5223, 1...
0
[ 0, 2.9355, 5.5654, 0, 0, 4.947, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 4.4523, 0, 0, 0, 0, 0, 4.0476, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 3.7103, 0, 0, 0, 0, 3.4249, 0,...
[ 8.2963, 14.4478, 11.6458, 6.5348, 6.5348, 10.4701, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0...
0.058
[ 0, -2.9498, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 12.7817, 0, 9.5864, 0, 0, 0, 0, 0, 0, 0, 0, 0, 7.6692, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
[ 19.4364, 20.0591, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975,...
0.021
[ 0, 2.9355, 5.5654, 0, 0, 4.947, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 4.4523, 0, 0, 0, 0, 0, 4.0476, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 3.7103, 0, 0, 0, 0, 3.4249, 0,...
[ 8.2963, 14.4478, 11.6458, 6.5348, 6.5348, 10.4701, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0169, 6.0...
0.058
[ 0, -2.9498, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 12.7817, 0, 9.5864, 0, 0, 0, 0, 0, 0, 0, 0, 0, 7.6692, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ...
[ 19.4364, 20.0591, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975, 19.3975,...
0.021
false
9,832,343
DE2
GGAAAGCUAGAAGGUGGGAGCGUAGCUCUCACGCCAGGUACGGGAAAACUGUACCUGGCACUUCUAGCGGGAUGCUUCGGCAUCCCAAAAGAAACAACAACAACAAC
.....((((((((((((((((...))))))))(((((((((((.....))))))))))).))))))))(((((((....))))))).....................
[ 1.2312, 1.7783, 1.7216, 0.9256000000000001, 0.6328, 0.022600000000000002, 0.033800000000000004, 0.0268, 0.022500000000000003, 0.0155, 0.0392, 0.028, 0.1705, 0.1963, 0.0149, -0.007, 0.0109, -0.007, 0.0258, 0.0149, 0.10160000000000001, 2.1739, 1.4409, 0.5928, 0.1043, ...
[ 0.1804, 0.18150000000000002, 0.16290000000000002, 0.1203, 0.0961, 0.0281, 0.0316, 0.033800000000000004, 0.028, 0.030500000000000003, 0.0329, 0.0297, 0.0572, 0.0689, 0.029900000000000003, 0.0177, 0.023, 0.0177, 0.0329, 0.0298, 0.0473, 0.1572, 0.1258, 0.085, 0.039400000...
5.203
[ 2.9189, 2.8386, 1.5867, 1.1223, 0.723, 0.4768, 0.4718, 0.1729, 0.09380000000000001, 0.17170000000000002, 0.1628, 0.08120000000000001, 0.319, 0.35860000000000003, 0.1666, -0.0036000000000000003, 0.0567, 0.0303, 0.0528, 0.0302, 0.052700000000000004, 0.45280000000000004, 0.2...
[ 0.378, 0.3326, 0.2426, 0.2036, 0.1568, 0.1313, 0.13, 0.09480000000000001, 0.0719, 0.09430000000000001, 0.08610000000000001, 0.0683, 0.1148, 0.1396, 0.09190000000000001, 0.049, 0.0604, 0.0623, 0.0687, 0.062200000000000005, 0.0685, 0.1368, 0.1086, 0.13870000000000002, 0...
2.787
[ 0.4038, 1.1513, 1.2313, 0.7995, 0.4752, 0.1947, 0.027800000000000002, 0.0979, 0.193, 0.0146, 0.055, 0.1371, 0.2862, 0.2736, 0.0945, 0.013900000000000001, 0, -0.0129, -0.0129, 0.013900000000000001, 0.2534, 0.2916, 0.4949, 0.9124, 0.0507, 0.1262, 0.0756, 0.0118, ...
[ 0.2469, 0.2569, 0.23390000000000002, 0.1912, 0.1438, 0.1022, 0.057100000000000005, 0.08710000000000001, 0.1013, 0.0609, 0.06770000000000001, 0.0896, 0.1202, 0.1369, 0.08460000000000001, 0.0596, 0.0298, 0.037200000000000004, 0.037200000000000004, 0.059500000000000004, 0.113800...
2.28
[ 2.9189, 2.8386, 1.5867, 1.1223, 0.723, 0.4768, 0.4718, 0.1729, 0.09380000000000001, 0.17170000000000002, 0.1628, 0.08120000000000001, 0.319, 0.35860000000000003, 0.1666, -0.0036000000000000003, 0.0567, 0.0303, 0.0528, 0.0302, 0.052700000000000004, 0.45280000000000004, 0.2...
[ 0.378, 0.3326, 0.2426, 0.2036, 0.1568, 0.1313, 0.13, 0.09480000000000001, 0.0719, 0.09430000000000001, 0.08610000000000001, 0.0683, 0.1148, 0.1396, 0.09190000000000001, 0.049, 0.0604, 0.0623, 0.0687, 0.062200000000000005, 0.0685, 0.1368, 0.1086, 0.13870000000000002, 0...
2.787
[ 0.4038, 1.1513, 1.2313, 0.7995, 0.4752, 0.1947, 0.027800000000000002, 0.0979, 0.193, 0.0146, 0.055, 0.1371, 0.2862, 0.2736, 0.0945, 0.013900000000000001, 0, -0.0129, -0.0129, 0.013900000000000001, 0.2534, 0.2916, 0.4949, 0.9124, 0.0507, 0.1262, 0.0756, 0.0118, ...
[ 0.2469, 0.2569, 0.23390000000000002, 0.1912, 0.1438, 0.1022, 0.057100000000000005, 0.08710000000000001, 0.1013, 0.0609, 0.06770000000000001, 0.0896, 0.1202, 0.1369, 0.08460000000000001, 0.0596, 0.0298, 0.037200000000000004, 0.037200000000000004, 0.059500000000000004, 0.113800...
2.28
true
9,832,349
Design01
GGAAAGAGAGAGAGAGAGAGAGAGAGAAGAAGAAGAAGAAGAAGAGAGAGAAGAGAGAAGAAGAGAGAAUAUAUGUUCGCAUAUAUAAAAGAAACAACAACAACAAC
....................................................................(((((((....))))))).....................
[ -0.0166, 0.2926, 0.8751, -0.0784, 0.049300000000000004, 0.07780000000000001, 0.0971, 0.0386, -0.0392, 0.019, 0.038400000000000004, 0.0187, 0, 0, 0.057600000000000005, -0.0195, 0.0574, 0.0947, 0.0375, 0.11330000000000001, 0, 0.2046, 0, 0.2726, 0.37870000000000004, 0....
[ 0.2659, 0.23750000000000002, 0.30160000000000003, 0.2711, 0.1401, 0.1726, 0.1463, 0.12290000000000001, 0.075, 0.1253, 0.1222, 0.1247, 0.0609, 0.0609, 0.1168, 0.0695, 0.1165, 0.1432, 0.1203, 0.1381, 0.0599, 0.17250000000000001, 0.059300000000000005, 0.19740000000000002, ...
1.751
[ 2.6281, 2.3801, 0.9589000000000001, 0.6138, 0.5076, 0.3089, 0.08750000000000001, 0.3438, -0.020200000000000003, 0.23470000000000002, 0.0216, -0.0204, 0.0635, 0.0634, 0.06330000000000001, -0.042, 0.1578, 0.052500000000000005, -0.0419, 0.0629, 0.06280000000000001, 0.331800000...
[ 0.6548, 0.5285000000000001, 0.3562, 0.51, 0.2828, 0.2844, 0.1781, 0.23750000000000002, 0.164, 0.2301, 0.1527, 0.1627, 0.1338, 0.1336, 0.1335, 0.1051, 0.16820000000000002, 0.1633, 0.1048, 0.1326, 0.13240000000000002, 0.2305, 0.1312, 0.1686, 0.17400000000000002, 0.291...
1.511
[ -0.1107, 1.5985, 1.2182, 0.4403, 0.1509, 0.6941, -0.036500000000000005, 0.28950000000000004, 0.0356, 0.035500000000000004, 0.07150000000000001, 0.1419, 0, 0, 0.1068, 0.2817, 0.1056, 0.0692, 0.27740000000000004, 0.2078, 0, -0.036000000000000004, 0.5127, 0.298, 0.599200...
[ 0.4933, 0.6075, 0.5159, 0.5867, 0.2848, 0.4358, 0.1316, 0.30560000000000004, 0.2338, 0.2331, 0.2273, 0.273, 0.1131, 0.1131, 0.2167, 0.2983, 0.2144, 0.2227, 0.2944, 0.2535, 0.11, 0.1265, 0.33380000000000004, 0.31980000000000003, 0.3463, 0.3733, 0.36970000000000003,...
1.456
[ 2.6281, 2.3801, 0.9589000000000001, 0.6138, 0.5076, 0.3089, 0.08750000000000001, 0.3438, -0.020200000000000003, 0.23470000000000002, 0.0216, -0.0204, 0.0635, 0.0634, 0.06330000000000001, -0.042, 0.1578, 0.052500000000000005, -0.0419, 0.0629, 0.06280000000000001, 0.331800000...
[ 0.6548, 0.5285000000000001, 0.3562, 0.51, 0.2828, 0.2844, 0.1781, 0.23750000000000002, 0.164, 0.2301, 0.1527, 0.1627, 0.1338, 0.1336, 0.1335, 0.1051, 0.16820000000000002, 0.1633, 0.1048, 0.1326, 0.13240000000000002, 0.2305, 0.1312, 0.1686, 0.17400000000000002, 0.291...
1.511
[ -0.1107, 1.5985, 1.2182, 0.4403, 0.1509, 0.6941, -0.036500000000000005, 0.28950000000000004, 0.0356, 0.035500000000000004, 0.07150000000000001, 0.1419, 0, 0, 0.1068, 0.2817, 0.1056, 0.0692, 0.27740000000000004, 0.2078, 0, -0.036000000000000004, 0.5127, 0.298, 0.599200...
[ 0.4933, 0.6075, 0.5159, 0.5867, 0.2848, 0.4358, 0.1316, 0.30560000000000004, 0.2338, 0.2331, 0.2273, 0.273, 0.1131, 0.1131, 0.2167, 0.2983, 0.2144, 0.2227, 0.2944, 0.2535, 0.11, 0.1265, 0.33380000000000004, 0.31980000000000003, 0.3463, 0.3733, 0.36970000000000003,...
1.456
true
9,832,356
Design02
GGAAAGAGAGAGAGAGAGAGAGAGAGAAGAAGAAGAAGAAGAAGAGAGAGAAGAGAGAAGAAGAGAGACUAAAUCUUCGGAUUUAGAAAAGAAACAACAACAACAAC
....................................................................(((((((....))))))).....................
[ 0.1333, 0.6001000000000001, 0.8054, 0.165, -0.015700000000000002, -0.0461, 0.0531, 0.14170000000000002, 0.10450000000000001, -0.0341, 0, -0.017, 0, 0, 0, 0.0181, -0.034, 0.052000000000000005, 0.0519, 0.0517, 0.0516, 0.30510000000000004, 0, 0.2172, 0.297, 0.582, 0....
[ 0.289, 0.30310000000000004, 0.2767, 0.2974, 0.1192, 0.1643, 0.1075, 0.16570000000000001, 0.1273, 0.0665, 0.055, 0.062400000000000004, 0.055, 0.055, 0.055, 0.1121, 0.0663, 0.10540000000000001, 0.1051, 0.10490000000000001, 0.1046, 0.1762, 0.0536, 0.1676, 0.1716, 0.241...
1.913
[ 2.0847, 1.4044, 1.6922, 0.5297000000000001, 0.45070000000000005, 0.3425, 0.1956, 0.3044, 0.0644, -0.0092, 0.06420000000000001, 0.1552, 0.2544, 0.1268, 0.1895, -0.0103, -0.0102, 0.2505, 0.0625, 0.062400000000000004, 0.18660000000000002, 0.2474, 0, 0.1729, 0.0614, 0.0...
[ 0.6313000000000001, 0.5046, 0.4349, 0.5164, 0.2891, 0.3356, 0.1819, 0.2599, 0.134, 0.1563, 0.1336, 0.18960000000000002, 0.1943, 0.1575, 0.1764, 0.15410000000000001, 0.1539, 0.19140000000000001, 0.1303, 0.1301, 0.1738, 0.18910000000000002, 0.0719, 0.20450000000000002, ...
1.807
[ -0.24130000000000001, 1.6666, 1.1452, 0.8363, 0.1958, 0.09860000000000001, 0.0799, -0.0471, 0.1588, 0.0159, 0.1578, -0.0316, 0.1572, 0, 0, 0.015300000000000001, -0.063, 0.07830000000000001, 0, 0.0781, 0, 0.3099, 0, 0.09140000000000001, 0.1537, 0.9413, 0.2955000000...
[ 0.4238, 0.5630000000000001, 0.4183, 0.5518000000000001, 0.2616, 0.3105, 0.16290000000000002, 0.1857, 0.1943, 0.1759, 0.19310000000000002, 0.10110000000000001, 0.1923, 0.0847, 0.0847, 0.1744, 0.10930000000000001, 0.1597, 0.0844, 0.15940000000000001, 0.08420000000000001, 0.23...
1.612
[ 2.0847, 1.4044, 1.6922, 0.5297000000000001, 0.45070000000000005, 0.3425, 0.1956, 0.3044, 0.0644, -0.0092, 0.06420000000000001, 0.1552, 0.2544, 0.1268, 0.1895, -0.0103, -0.0102, 0.2505, 0.0625, 0.062400000000000004, 0.18660000000000002, 0.2474, 0, 0.1729, 0.0614, 0.0...
[ 0.6313000000000001, 0.5046, 0.4349, 0.5164, 0.2891, 0.3356, 0.1819, 0.2599, 0.134, 0.1563, 0.1336, 0.18960000000000002, 0.1943, 0.1575, 0.1764, 0.15410000000000001, 0.1539, 0.19140000000000001, 0.1303, 0.1301, 0.1738, 0.18910000000000002, 0.0719, 0.20450000000000002, ...
1.807
[ -0.24130000000000001, 1.6666, 1.1452, 0.8363, 0.1958, 0.09860000000000001, 0.0799, -0.0471, 0.1588, 0.0159, 0.1578, -0.0316, 0.1572, 0, 0, 0.015300000000000001, -0.063, 0.07830000000000001, 0, 0.0781, 0, 0.3099, 0, 0.09140000000000001, 0.1537, 0.9413, 0.2955000000...
[ 0.4238, 0.5630000000000001, 0.4183, 0.5518000000000001, 0.2616, 0.3105, 0.16290000000000002, 0.1857, 0.1943, 0.1759, 0.19310000000000002, 0.10110000000000001, 0.1923, 0.0847, 0.0847, 0.1744, 0.10930000000000001, 0.1597, 0.0844, 0.15940000000000001, 0.08420000000000001, 0.23...
1.612
true
9,832,358
Design03
GGAAAGAGAGAGAGAGAGAGAGAGAGAAGAAGAAGAAGAAGAAGAGAGAGAAGAGAGAAGAAGAGAGACUAGAUCUUCGGAUUUGGAAAAGAAACAACAACAACAAC
....................................................................(((((((....))))))).....................
[ 0.47150000000000003, 1.0082, 0.7786000000000001, -0.029, 0.10540000000000001, 0.061900000000000004, 0.027200000000000002, 0.0171, 0, 0.1495, 0.0563, -0.0199, -0.0199, -0.0198, 0.0562, 0.056, 0.055900000000000005, 0.0359, -0.0198, -0.0198, 0, 0.146, 0.1645, 0.0893, 0.1...
[ 0.31, 0.3432, 0.3024, 0.3045, 0.14350000000000002, 0.1701, 0.12250000000000001, 0.1236, 0.0603, 0.1593, 0.1144, 0.0689, 0.0689, 0.0689, 0.11410000000000001, 0.11380000000000001, 0.1135, 0.1183, 0.0683, 0.0683, 0.0591, 0.15610000000000002, 0.1511, 0.1375, 0.1666, 0.2...
1.745
[ 3.6701, 2.1466, 1.328, 0.8461000000000001, 0.45270000000000005, 0.8863000000000001, 0.1328, 0.2406, 0.195, 0.4711, 0.06420000000000001, 0.14880000000000002, 0.08460000000000001, 0.2106, 0.0632, 0.1889, 0, -0.0427, -0.0426, 0.083, 0.0627, 0.1448, 0, 0.5125000000000001, ...
[ 0.7004, 0.5356000000000001, 0.4415, 0.5777, 0.2579, 0.3678, 0.20350000000000001, 0.2353, 0.1827, 0.2605, 0.1353, 0.19440000000000002, 0.176, 0.2083, 0.1335, 0.1773, 0.0761, 0.1061, 0.106, 0.1739, 0.1325, 0.1907, 0.0756, 0.2609, 0.2156, 0.2733, 0.1854, 0.2102, ...
1.695
[ 0.45030000000000003, 1.7591, 0.6915, 0.4022, 1.0729, 0.3573, 0.0378, 0.20400000000000001, 0.27590000000000003, 0.0548, 0.1826, -0.0369, 0.054200000000000005, 0.0541, 0, 0, 0, 0.0539, -0.0367, 0.053700000000000005, 0, 0.0536, 0.1796, 0.1422, 0.22970000000000002, 0.97...
[ 0.48210000000000003, 0.5881000000000001, 0.4319, 0.5891000000000001, 0.42160000000000003, 0.3456, 0.20400000000000001, 0.26830000000000004, 0.2539, 0.1978, 0.2235, 0.1174, 0.1965, 0.1961, 0.098, 0.098, 0.098, 0.1957, 0.11670000000000001, 0.1952, 0.0976, 0.1948, 0.2199, ...
1.362
[ 3.6701, 2.1466, 1.328, 0.8461000000000001, 0.45270000000000005, 0.8863000000000001, 0.1328, 0.2406, 0.195, 0.4711, 0.06420000000000001, 0.14880000000000002, 0.08460000000000001, 0.2106, 0.0632, 0.1889, 0, -0.0427, -0.0426, 0.083, 0.0627, 0.1448, 0, 0.5125000000000001, ...
[ 0.7004, 0.5356000000000001, 0.4415, 0.5777, 0.2579, 0.3678, 0.20350000000000001, 0.2353, 0.1827, 0.2605, 0.1353, 0.19440000000000002, 0.176, 0.2083, 0.1335, 0.1773, 0.0761, 0.1061, 0.106, 0.1739, 0.1325, 0.1907, 0.0756, 0.2609, 0.2156, 0.2733, 0.1854, 0.2102, ...
1.695
[ 0.45030000000000003, 1.7591, 0.6915, 0.4022, 1.0729, 0.3573, 0.0378, 0.20400000000000001, 0.27590000000000003, 0.0548, 0.1826, -0.0369, 0.054200000000000005, 0.0541, 0, 0, 0, 0.0539, -0.0367, 0.053700000000000005, 0, 0.0536, 0.1796, 0.1422, 0.22970000000000002, 0.97...
[ 0.48210000000000003, 0.5881000000000001, 0.4319, 0.5891000000000001, 0.42160000000000003, 0.3456, 0.20400000000000001, 0.26830000000000004, 0.2539, 0.1978, 0.2235, 0.1174, 0.1965, 0.1961, 0.098, 0.098, 0.098, 0.1957, 0.11670000000000001, 0.1952, 0.0976, 0.1948, 0.2199, ...
1.362
true
9,832,419
DE3
GGAAAGCUAGGACGUGGGAGCGUAGCUCUCCACACGGGUACGCCAAAGGUGUACACCGGGUCACUAGCGCCAUGCUUCGGCAUGGCAAAAGAAACAACAACAACAAC
.....((((((((((((((((...)))).)))).((((((((((...))))))).))).))).)))))(((((((....))))))).....................
[ 1.0102, 1.7928, 1.9228, 0.9649000000000001, 0.5666, 0.2154, 0.0455, 0.012700000000000001, 0.02, 0.025400000000000002, 0.27690000000000003, 0.2242, 1.0684, 0.49770000000000003, 0.2255, 0.0621, 0.0507, 0.095, 0.056, 0.0444, 0.1978, 2.0917, 1.2969, 0.553, 0.1053, 0.178...
[ 0.1782, 0.2043, 0.1842, 0.13240000000000002, 0.1019, 0.07050000000000001, 0.0396, 0.026000000000000002, 0.0325, 0.031100000000000003, 0.0736, 0.0675, 0.1274, 0.09040000000000001, 0.061900000000000004, 0.0402, 0.0378, 0.0459, 0.0405, 0.0337, 0.0579, 0.1559, 0.1194, 0.085...
6.545
[ 2.3588, 2.2161, 1.2522, 0.7875000000000001, 0.593, 0.2831, 0.2914, 0.12440000000000001, 0.16540000000000002, 0.22890000000000002, 0.2046, 0.134, 1.0971, 0.42150000000000004, 0.26730000000000004, 0.09680000000000001, 0.0883, 0.23650000000000002, 0.19090000000000001, 0.0985, 0....
[ 0.2958, 0.28140000000000004, 0.19410000000000002, 0.1575, 0.132, 0.1032, 0.0942, 0.0658, 0.0772, 0.0819, 0.0854, 0.0752, 0.1651, 0.1129, 0.0843, 0.0635, 0.0618, 0.0838, 0.08070000000000001, 0.057800000000000004, 0.0543, 0.11030000000000001, 0.0893, 0.1129, 0.082, 0....
3.865
[ 0.7043, 1.4864, 1.3035, 1.2176, 0.8290000000000001, 0.2713, 0.31970000000000004, 0.2821, 0.1474, 0.1567, 0.335, 0.11270000000000001, 0.9947, 0.33330000000000004, 0.21150000000000002, 0.0956, 0.11620000000000001, 0.0426, 0.2409, 0.0417, 0.2278, 0.2796, 0.4162, 0.8224, ...
[ 0.2379, 0.27590000000000003, 0.22160000000000002, 0.20650000000000002, 0.1688, 0.1134, 0.1111, 0.1029, 0.0843, 0.08220000000000001, 0.1135, 0.0799, 0.17750000000000002, 0.116, 0.0886, 0.0711, 0.0752, 0.0577, 0.0976, 0.051300000000000005, 0.08990000000000001, 0.1111, 0.115...
3.152
[ 2.3588, 2.2161, 1.2522, 0.7875000000000001, 0.593, 0.2831, 0.2914, 0.12440000000000001, 0.16540000000000002, 0.22890000000000002, 0.2046, 0.134, 1.0971, 0.42150000000000004, 0.26730000000000004, 0.09680000000000001, 0.0883, 0.23650000000000002, 0.19090000000000001, 0.0985, 0....
[ 0.2958, 0.28140000000000004, 0.19410000000000002, 0.1575, 0.132, 0.1032, 0.0942, 0.0658, 0.0772, 0.0819, 0.0854, 0.0752, 0.1651, 0.1129, 0.0843, 0.0635, 0.0618, 0.0838, 0.08070000000000001, 0.057800000000000004, 0.0543, 0.11030000000000001, 0.0893, 0.1129, 0.082, 0....
3.865
[ 0.7043, 1.4864, 1.3035, 1.2176, 0.8290000000000001, 0.2713, 0.31970000000000004, 0.2821, 0.1474, 0.1567, 0.335, 0.11270000000000001, 0.9947, 0.33330000000000004, 0.21150000000000002, 0.0956, 0.11620000000000001, 0.0426, 0.2409, 0.0417, 0.2278, 0.2796, 0.4162, 0.8224, ...
[ 0.2379, 0.27590000000000003, 0.22160000000000002, 0.20650000000000002, 0.1688, 0.1134, 0.1111, 0.1029, 0.0843, 0.08220000000000001, 0.1135, 0.0799, 0.17750000000000002, 0.116, 0.0886, 0.0711, 0.0752, 0.0577, 0.0976, 0.051300000000000005, 0.08990000000000001, 0.1111, 0.115...
3.152
true
9,832,453
Design04
GGAAACGGCAAGGGCACGGAAACGGCCCGGGCGCGCGACGGGCGAAAGCCCGUGGCGCCCAAGCCGGACUUAAUAUUCGUAUUAAGAAAAGAAACAACAACAACAAC
.....((((..((((.((....))))))((((((.(.((((((....)))))))))))))..))))..(((((((....))))))).....................
[ 0.5994, 0.018000000000000002, 1.0679, 0.8675, 0.0123, 0, 0, 0.0713, -0.059300000000000005, 0.3851, 0.3781, 0, 0, -0.0591, 0, 0.49210000000000004, 0.1223, 0.1216, 0.3584, 1.1294, 0.6562, 0, 0.10880000000000001, 0.1082, 0, 0, 0, 0.2142, 0, 0.10650000000000001,...
[ 0.5138, 0.4601, 0.5787, 0.49770000000000003, 0.30010000000000003, 0.14450000000000002, 0.14450000000000002, 0.2874, 0.1766, 0.3557, 0.34940000000000004, 0.1393, 0.1393, 0.1728, 0.13920000000000002, 0.3738, 0.2516, 0.2503, 0.3317, 0.4738, 0.38180000000000003, 0.1243000000000...
0.969
[ 0.7738, 2.2723, 0.3195, 0.6658000000000001, 0.5241, 0.19440000000000002, 0.19360000000000002, 0.0646, 0.2544, 0.3789, 0, 0, 0.5612, -0.1274, 0.18630000000000002, 0.1855, 0, 0.1847, 0.5474, 0.1817, 0.181, 0, 0.18030000000000002, 0, 0.17950000000000002, 0.178800000000...
[ 0.7954, 1.1217, 0.6804, 0.6499, 0.6629, 0.40950000000000003, 0.40790000000000004, 0.46290000000000003, 0.5274, 0.47490000000000004, 0.2285, 0.2285, 0.5268, 0.3161, 0.39380000000000004, 0.39230000000000004, 0.225, 0.39080000000000004, 0.5146000000000001, 0.3851, 0.383700000000...
0.723
[ 0.029500000000000002, 1.5898, 1.2332, 1.3952, 0.31880000000000003, 0, 0.2682, 0.2877, 0.5421, 0.2591, 0, 0, 0.2574, -0.1097, 0, 0, 0.5079, 0, 0.2523, 0.2506, 0.7375, 0.4854, 0, 0, 0.4793, 0, 0, 0, 0, 0, 0, 0.47340000000000004, 0.2353, 0.3497, 0.574...
[ 0.6999000000000001, 1.2099, 1.0013, 0.9429000000000001, 0.7046, 0.2919, 0.5476, 0.6303000000000001, 0.7084, 0.5298, 0.28150000000000003, 0.28150000000000003, 0.5264, 0.3382, 0.2798, 0.2798, 0.6228, 0.2766, 0.5164, 0.5131, 0.6805, 0.5961000000000001, 0.2664, 0.2664, 0....
0.519
[ 0.7738, 2.2723, 0.3195, 0.6658000000000001, 0.5241, 0.19440000000000002, 0.19360000000000002, 0.0646, 0.2544, 0.3789, 0, 0, 0.5612, -0.1274, 0.18630000000000002, 0.1855, 0, 0.1847, 0.5474, 0.1817, 0.181, 0, 0.18030000000000002, 0, 0.17950000000000002, 0.178800000000...
[ 0.7954, 1.1217, 0.6804, 0.6499, 0.6629, 0.40950000000000003, 0.40790000000000004, 0.46290000000000003, 0.5274, 0.47490000000000004, 0.2285, 0.2285, 0.5268, 0.3161, 0.39380000000000004, 0.39230000000000004, 0.225, 0.39080000000000004, 0.5146000000000001, 0.3851, 0.383700000000...
0.723
[ 0.029500000000000002, 1.5898, 1.2332, 1.3952, 0.31880000000000003, 0, 0.2682, 0.2877, 0.5421, 0.2591, 0, 0, 0.2574, -0.1097, 0, 0, 0.5079, 0, 0.2523, 0.2506, 0.7375, 0.4854, 0, 0, 0.4793, 0, 0, 0, 0, 0, 0, 0.47340000000000004, 0.2353, 0.3497, 0.574...
[ 0.6999000000000001, 1.2099, 1.0013, 0.9429000000000001, 0.7046, 0.2919, 0.5476, 0.6303000000000001, 0.7084, 0.5298, 0.28150000000000003, 0.28150000000000003, 0.5264, 0.3382, 0.2798, 0.2798, 0.6228, 0.2766, 0.5164, 0.5131, 0.6805, 0.5961000000000001, 0.2664, 0.2664, 0....
0.519
false
9,832,487
All Rolled Up: -20.2 kcal all constraints satisfied
GGAAAAUAAAAAUAAAAAUAAAAAUAAAAAUAAAAAUAAAAAUAAAAAUAAAAUAAUAAAUAAAUAAAGCGGGCCUUCGGGCCCGCAAAAGAAACAACAACAACAAC
....................................................................(((((((....))))))).....................
[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 6.8892, 0, 0, 0, 0, 0, 0, 5.167, 0, 0, 0, 4.1336, 0, 0, 3.4447, 0, 0, -2.2965, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0...
[ 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 10.6515, 14.0185, 7.3577, 7.3577, 7.3577, 7.3577, 7.3577, 7.3577, 10.652, 5.77...
0.05
[ 0, 0, 0, 0, 4.0475, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 6.8497, 5.9364, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 5.238, 0, 0, 0, 0, 0, 8.4806, 0, 0, -4.947, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 3.8716, 0, 0, 0,...
[ 10.5006, 10.5006, 10.5006, 10.5006, 14.8976, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 14.7867, 13.1125, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 11.8626, 7.6427, ...
0.054
[ 0, 0, 12.7817, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, -4.2608, 0, 9.5864, 0, 7.6692, 0, 0, 0, 0, 0, 6.3911, 0, 0, 0, 0, 0, 0, 0, 5.4781, ...
[ 19.762, 19.762, 26.0089, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, ...
0.048
[ 0, 0, 0, 0, 4.0475, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 6.8497, 5.9364, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 5.238, 0, 0, 0, 0, 0, 8.4806, 0, 0, -4.947, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 3.8716, 0, 0, 0,...
[ 10.5006, 10.5006, 10.5006, 10.5006, 14.8976, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 9.8236, 14.7867, 13.1125, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 8.1372, 11.8626, 7.6427, ...
0.054
[ 0, 0, 12.7817, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, -4.2608, 0, 9.5864, 0, 7.6692, 0, 0, 0, 0, 0, 6.3911, 0, 0, 0, 0, 0, 0, 0, 5.4781, ...
[ 19.762, 19.762, 26.0089, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, 13.6509, ...
0.048
false
9,832,496
First own roll
GGAAAAUAAUAAUAAUACAUAUAGAAUUAUAAGAUACUAUUAUCGAUAUAUUGGAUAUAAUUAAGAAACUAGAGGUUCGCUUUUAGAAAAGAAACAACAACAACAAC
....................((((.(((....))).))))((((.(.....).))))...........(((((((....))))))).....................
[ 0.4257, 1.924, 1.4112, -0.0649, 0.13040000000000002, 0.47700000000000004, -0.0323, 0.1578, 0.5479, 0.5948, 0.5782, 0.6661, 0.4797, 0.91, 0.5368, 1.7578, 0.22840000000000002, 0.5168, 0.8499, 0.2786, 0.6989000000000001, 0.13520000000000001, 0.3257, 0.8909, 1.1539, 0.7...
[ 0.5483, 0.7966000000000001, 0.6608, 0.18180000000000002, 0.33190000000000003, 0.43560000000000004, 0.1716, 0.31720000000000004, 0.46590000000000004, 0.44730000000000003, 0.4348, 0.4565, 0.4152, 0.47500000000000003, 0.39980000000000004, 0.5736, 0.2775, 0.4187, 0.4284, 0.2892, ...
1.838
[ 2.9676, 1.9677, 0.47990000000000005, 1.7599, 0.22510000000000002, 1.149, 0.7757000000000001, 0.1124, 0.5256000000000001, 1.1859, 0.8461000000000001, 0.45320000000000005, 0.6824, 0.7067, 0.3312, 0.9096000000000001, 0.0976, 0.597, 0.3603, 0.6713, 1.5169, 0.3068, -0.0463, ...
[ 0.8299000000000001, 0.7164, 0.43560000000000004, 0.6172000000000001, 0.33490000000000003, 0.4833, 0.4439, 0.2354, 0.4172, 0.47050000000000003, 0.4108, 0.36560000000000004, 0.4268, 0.3745, 0.3304, 0.43, 0.2071, 0.4983, 0.37320000000000003, 0.37870000000000004, 0.4621, 0.329,...
1.555
[ 0.5189, 2.0514, 0.7293000000000001, 0.8014, 0.30510000000000004, 0.5401, 0.4726, 0.5253, 1.2318, 0.664, 0.5724, 1.1287, 1.108, 0.3043, 0.0921, 0.5375, 0.5877, 0.9460000000000001, 0.1058, 0.6314000000000001, 0.8102, 0.4164, 0.016800000000000002, 0.9278000000000001, 1.0...
[ 0.6494, 0.9008, 0.6074, 0.6141, 0.45690000000000003, 0.4955, 0.49970000000000003, 0.48210000000000003, 0.6627000000000001, 0.5016, 0.4733, 0.6043000000000001, 0.6046, 0.37220000000000003, 0.3256, 0.4631, 0.44480000000000003, 0.6303000000000001, 0.37470000000000003, 0.4614000000...
1.429
[ 2.9676, 1.9677, 0.47990000000000005, 1.7599, 0.22510000000000002, 1.149, 0.7757000000000001, 0.1124, 0.5256000000000001, 1.1859, 0.8461000000000001, 0.45320000000000005, 0.6824, 0.7067, 0.3312, 0.9096000000000001, 0.0976, 0.597, 0.3603, 0.6713, 1.5169, 0.3068, -0.0463, ...
[ 0.8299000000000001, 0.7164, 0.43560000000000004, 0.6172000000000001, 0.33490000000000003, 0.4833, 0.4439, 0.2354, 0.4172, 0.47050000000000003, 0.4108, 0.36560000000000004, 0.4268, 0.3745, 0.3304, 0.43, 0.2071, 0.4983, 0.37320000000000003, 0.37870000000000004, 0.4621, 0.329,...
1.555
[ 0.5189, 2.0514, 0.7293000000000001, 0.8014, 0.30510000000000004, 0.5401, 0.4726, 0.5253, 1.2318, 0.664, 0.5724, 1.1287, 1.108, 0.3043, 0.0921, 0.5375, 0.5877, 0.9460000000000001, 0.1058, 0.6314000000000001, 0.8102, 0.4164, 0.016800000000000002, 0.9278000000000001, 1.0...
[ 0.6494, 0.9008, 0.6074, 0.6141, 0.45690000000000003, 0.4955, 0.49970000000000003, 0.48210000000000003, 0.6627000000000001, 0.5016, 0.4733, 0.6043000000000001, 0.6046, 0.37220000000000003, 0.3256, 0.4631, 0.44480000000000003, 0.6303000000000001, 0.37470000000000003, 0.4614000000...
1.429
false
9,832,500
Steve’s Roll your own structure #1
GGAAAGAGGGAGCGAAAGCUCACCAUCACGGUCGAAGCGCUACGAUGAGAGAAAGUAGCGAAGACAAACGUUACGUUCGCGUAACGAAAAGAAACAACAACAACAAC
.....((((((((....)))).)).))...(((....((((((...........))))))..)))...(((((((....))))))).....................
[ 0.5005000000000001, 1.0234, 1.2236, 0.876, 0.6734, 0.6467, 0.1444, 0.0092, 0.0092, 0.062400000000000004, 0.037, -0.0014, 0.0128, 0.22690000000000002, 0.7783, 0.3236, 0.29910000000000003, 0.051500000000000004, 0.0194, 0.0086, 0.0618, 1.0658, 0.0279, 0.1797, 1.2185, 0...
[ 0.0941, 0.1114, 0.1091, 0.0922, 0.0813, 0.07690000000000001, 0.040600000000000004, 0.019200000000000002, 0.019200000000000002, 0.0291, 0.0256, 0.023200000000000002, 0.0268, 0.0504, 0.08, 0.0539, 0.0505, 0.028800000000000003, 0.0219, 0.0162, 0.0316, 0.08710000000000001, 0....
8.964
[ 2.1815, 2.8696, 1.3163, 0.8374, 1.0986, 0.8565, 0.2988, 0.1401, 0.4359, 0.1547, 0.1799, 0.033600000000000005, 0.046, 0.0835, 0.19490000000000002, 0.15910000000000002, 0.1247, 0.14880000000000002, 0.2738, 0.0361, 0.3584, 0.6852, 0.33330000000000004, 0.7633000000000001, ...
[ 0.17850000000000002, 0.1844, 0.12140000000000001, 0.10070000000000001, 0.111, 0.09580000000000001, 0.0603, 0.0454, 0.0688, 0.0449, 0.0489, 0.0412, 0.0438, 0.0483, 0.0551, 0.048600000000000004, 0.04, 0.0488, 0.0572, 0.0281, 0.0664, 0.0818, 0.0575, 0.0844, 0.1048, 0.0...
7.251
[ 0.6964, 1.5829, 1.5058, 0.8399000000000001, 0.6843, 0.7626000000000001, 0.2748, 0.2015, 0.219, 0.11380000000000001, 0.0591, 0.02, -0.0184, 0.3594, 0.31820000000000004, 0.4723, 0.1842, 0.027800000000000002, 0.066, 0.0279, 0.2767, 0.2672, 0.15330000000000002, 0.4604000000...
[ 0.13290000000000002, 0.1585, 0.1395, 0.1086, 0.1, 0.0994, 0.0636, 0.056, 0.0575, 0.0441, 0.0376, 0.0402, 0.034800000000000005, 0.0743, 0.069, 0.07730000000000001, 0.0506, 0.0361, 0.039400000000000004, 0.028300000000000002, 0.0651, 0.061700000000000005, 0.04640000000000000...
6.176
[ 2.1815, 2.8696, 1.3163, 0.8374, 1.0986, 0.8565, 0.2988, 0.1401, 0.4359, 0.1547, 0.1799, 0.033600000000000005, 0.046, 0.0835, 0.19490000000000002, 0.15910000000000002, 0.1247, 0.14880000000000002, 0.2738, 0.0361, 0.3584, 0.6852, 0.33330000000000004, 0.7633000000000001, ...
[ 0.17850000000000002, 0.1844, 0.12140000000000001, 0.10070000000000001, 0.111, 0.09580000000000001, 0.0603, 0.0454, 0.0688, 0.0449, 0.0489, 0.0412, 0.0438, 0.0483, 0.0551, 0.048600000000000004, 0.04, 0.0488, 0.0572, 0.0281, 0.0664, 0.0818, 0.0575, 0.0844, 0.1048, 0.0...
7.251
[ 0.6964, 1.5829, 1.5058, 0.8399000000000001, 0.6843, 0.7626000000000001, 0.2748, 0.2015, 0.219, 0.11380000000000001, 0.0591, 0.02, -0.0184, 0.3594, 0.31820000000000004, 0.4723, 0.1842, 0.027800000000000002, 0.066, 0.0279, 0.2767, 0.2672, 0.15330000000000002, 0.4604000000...
[ 0.13290000000000002, 0.1585, 0.1395, 0.1086, 0.1, 0.0994, 0.0636, 0.056, 0.0575, 0.0441, 0.0376, 0.0402, 0.034800000000000005, 0.0743, 0.069, 0.07730000000000001, 0.0506, 0.0361, 0.039400000000000004, 0.028300000000000002, 0.0651, 0.061700000000000005, 0.04640000000000000...
6.176
true
9,832,505
Steve’s Roll your own structure #2
GGAAAGAGGGAGCGAAAGCUCACCAUCACGGUCGAAGCGCUACGGCGAGAAGCGGUAGCGAAGACAAACGCUACGUUCGCGUAGCGAAAAGAAACAACAACAACAAC
.....((((((((....)))).)).))...(((....((((((.((.....)).))))))..)))...(((((((....))))))).....................
[ 0.6472, 1.2161, 1.2919, 0.9652000000000001, 0.6371, 0.6301, 0.221, 0.0449, 0.04, 0.0558, 0.0287, 0.0349, 0.0039000000000000003, 0.1265, 0.7557, 0.3568, 0.227, 0.10590000000000001, 0.0344, 0.0258, 0.10740000000000001, 1.0986, 0.0241, 0.2596, 1.15, 0.2758, 0.4528000...
[ 0.13720000000000002, 0.1597, 0.1453, 0.1275, 0.10740000000000001, 0.0989, 0.0632, 0.034, 0.0349, 0.036500000000000005, 0.031900000000000005, 0.035300000000000005, 0.032600000000000004, 0.0558, 0.1023, 0.0756, 0.0599, 0.0466, 0.0358, 0.029400000000000003, 0.0471, 0.113700000...
6.082
[ 2.6725, 3.0789, 1.4936, 0.8161, 0.8135, 0.6912, 0.4283, 0.185, 0.3415, 0.0763, 0.11910000000000001, 0.0781, -0.006, 0.0792, 0.1696, 0.19290000000000002, 0.2871, 0.1668, 0.2582, 0.1071, 0.3618, 0.6422, 0.2962, 0.7993, 1.4687000000000001, 0.3663, 0.8095, 0.2425000...
[ 0.2802, 0.2791, 0.1849, 0.1529, 0.153, 0.1279, 0.1019, 0.06960000000000001, 0.091, 0.0505, 0.0631, 0.0594, 0.053200000000000004, 0.0733, 0.0777, 0.0844, 0.0839, 0.0731, 0.0857, 0.059800000000000006, 0.09430000000000001, 0.1159, 0.08700000000000001, 0.1272, 0.1635, 0...
4.464
[ 0.9535, 1.7317, 1.3537000000000001, 0.9309000000000001, 0.991, 0.5851000000000001, 0.25570000000000004, 0.19440000000000002, 0.146, 0.1158, 0.0297, 0.0784, 0.0516, 0.3836, 0.39580000000000004, 0.2907, 0.1761, 0.10690000000000001, 0.2436, 0.06420000000000001, 0.335300000000000...
[ 0.22110000000000002, 0.2515, 0.1998, 0.1762, 0.17880000000000001, 0.1341, 0.0951, 0.0814, 0.0762, 0.06720000000000001, 0.049800000000000004, 0.0658, 0.0684, 0.1155, 0.1119, 0.10310000000000001, 0.079, 0.0709, 0.0927, 0.057600000000000005, 0.1019, 0.1028, 0.0753, 0.1159,...
3.755
[ 2.6725, 3.0789, 1.4936, 0.8161, 0.8135, 0.6912, 0.4283, 0.185, 0.3415, 0.0763, 0.11910000000000001, 0.0781, -0.006, 0.0792, 0.1696, 0.19290000000000002, 0.2871, 0.1668, 0.2582, 0.1071, 0.3618, 0.6422, 0.2962, 0.7993, 1.4687000000000001, 0.3663, 0.8095, 0.2425000...
[ 0.2802, 0.2791, 0.1849, 0.1529, 0.153, 0.1279, 0.1019, 0.06960000000000001, 0.091, 0.0505, 0.0631, 0.0594, 0.053200000000000004, 0.0733, 0.0777, 0.0844, 0.0839, 0.0731, 0.0857, 0.059800000000000006, 0.09430000000000001, 0.1159, 0.08700000000000001, 0.1272, 0.1635, 0...
4.464
[ 0.9535, 1.7317, 1.3537000000000001, 0.9309000000000001, 0.991, 0.5851000000000001, 0.25570000000000004, 0.19440000000000002, 0.146, 0.1158, 0.0297, 0.0784, 0.0516, 0.3836, 0.39580000000000004, 0.2907, 0.1761, 0.10690000000000001, 0.2436, 0.06420000000000001, 0.335300000000000...
[ 0.22110000000000002, 0.2515, 0.1998, 0.1762, 0.17880000000000001, 0.1341, 0.0951, 0.0814, 0.0762, 0.06720000000000001, 0.049800000000000004, 0.0658, 0.0684, 0.1155, 0.1119, 0.10310000000000001, 0.079, 0.0709, 0.0927, 0.057600000000000005, 0.1019, 0.1028, 0.0753, 0.1159,...
3.755
true
End of preview. Expand in Data Studio

RYOS

RYOS

RYOS is a database of RNA backbone stability in aqueous solution.

RYOS focuses on exploring the stability of mRNA molecules for vaccine applications. This dataset is part of a broader effort to address one of the key challenges of mRNA vaccines: degradation during shipping and storage.

Statement

Deep learning models for predicting RNA degradation via dual crowdsourcing is published in Nature Machine Intelligence, which is a Closed Access / Author-Fee journal.

Machine learning has been at the forefront of the movement for free and open access to research.

We see no role for closed access or author-fee publication in the future of machine learning research and believe the adoption of these journals as an outlet of record for the machine learning community would be a retrograde step.

The MultiMolecule team is committed to the principles of open access and open science.

We do NOT endorse the publication of manuscripts in Closed Access / Author-Fee journals and encourage the community to support Open Access journals and conferences.

Please consider signing the Statement on Nature Machine Intelligence.

Disclaimer

This is an UNOFFICIAL release of the RYOS by Hannah K. Wayment-Steele, et al.

The team releasing RYOS did not write this dataset card for this dataset so this dataset card has been written by the MultiMolecule team.

Example Entry

id design sequence secondary_structure reactivity errors_reactivity signal_to_noise_reactivity deg_pH10 errors_deg_pH10 signal_to_noise_deg_pH10 deg_50C errors_deg_50C signal_to_noise_deg_50C deg_Mg_pH10 errors_deg_Mg_pH10 signal_to_noise_deg_Mg_pH10 deg_Mg_50C errors_deg_Mg_50C signal_to_noise_deg_Mg_50C SN_filter
9830366 testing GGAAAUUUGC... .......(((... [0.4167, 1.5941, 1.2359, ...] [0.1689, 0.2323, 0.193, ...] 5.326 [1.5966, 2.6482, 1.3761, ...] [0.3058, 0.3294, 0.233, ...] 4.198 [0.7885, 1.93, 2.0423, ...] 3.746 [0.2773, 0.328, 0.3048, ...] [1.5966, 2.6482, 1.3761, ...] [0.3058, 0.3294, 0.233, ...] 4.198 [0.7885, 1.93, 2.0423, ...] [0.2773, 0.328, 0.3048, ...] 3.746 True

Column Description

  • id: A unique identifier for each RNA sequence entry.

  • design: The name given to each RNA design by contributors, used for easy reference.

  • sequence: The nucleotide sequence of the RNA molecule, represented using the standard RNA bases:

    • A: Adenine
    • C: Cytosine
    • G: Guanine
    • U: Uracil
  • secondary_structure: The secondary structure of the RNA represented in dot-bracket notation, using up to three types of symbols to indicate base pairing and unpaired regions, as per bpRNA's standard:

    • Dots (.): Represent unpaired nucleotides.
    • Parentheses (( and )): Represent base pairs in standard stems (page 1).
    • Square Brackets ([ and ]): Represent base pairs in pseudoknots (page 2).
    • Curly Braces ({ and }): Represent base pairs in additional pseudoknots (page 3).
  • reactivity: A list of floating-point values that provide an estimate of the likelihood of the RNA backbone being cut at each nucleotide position. These values help determine the stability of the RNA structure under various experimental conditions.

  • deg_pH10 and deg_Mg_pH10: Arrays of degradation rates observed under two conditions: incubation at pH 10 without and with magnesium, respectively. These values provide insight into how different conditions affect the stability of RNA molecules.

  • deg_50C and deg_Mg_50C: Arrays of degradation rates after incubation at 50°C, without and with magnesium. These values capture how RNA sequences respond to elevated temperatures, which is relevant for storage and transportation conditions.

  • *_error_* Columns: Arrays of floating-point numbers indicating the experimental errors corresponding to the measurements in the reactivity and deg_ columns. These values help quantify the uncertainty in the degradation rates and reactivity measurements.

  • SN_filter: A filter applied to the dataset based on the signal-to-noise ratio, indicating whether a specific sequence meets the dataset’s quality criteria.

    If the SN_filter is True, the sequence meets the quality criteria; otherwise, it does not.

Note that due to technical limitations, the ground truth measurements are not available for the final bases of each RNA sequence. To facilitate processing, all measurement arrays (reactivity, deg_pH10, deg_50C, deg_Mg_pH10, deg_Mg_50C and their corresponding error fields) are padded with None values to match the full sequence length. When working with this data, please be aware that the trailing elements of these arrays are padding values and do not represent actual measurements.

Variations

This dataset is available in two subsets:

  • RYOS-1: The RYOS dataset from round 1 of the Eterna RYOS lab. The sequence length for RYOS-1 is 107, and the label length is 68.
  • RYOS-2: The RYOS dataset from round 2 of the Eterna RYOS lab. The sequence length for RYOS-2 is 130, and the label length is 102.

Preprocess

The MultiMolecule team preprocess this dataset by the following steps:

  1. Compute signal_to_noise by averaging all 5 signal_to_noise_* columns.
  2. Remove all sequence whose signal_to_noise < 1.
  3. Remove all sequence without proper secondary structure (i.e., the secondary structure in dot-bracket notation do not match).
  4. Padding/truncating all chemical measurements to sequence length.

License

This dataset is licensed under the AGPL-3.0 License.

SPDX-License-Identifier: AGPL-3.0-or-later

Citation

@article{waymentsteele2021deep,
  author  = {Wayment-Steele, Hannah K and Kladwang, Wipapat and Watkins, Andrew M and Kim, Do Soon and Tunguz, Bojan and Reade, Walter and Demkin, Maggie and Romano, Jonathan and Wellington-Oguri, Roger and Nicol, John J and Gao, Jiayang and Onodera, Kazuki and Fujikawa, Kazuki and Mao, Hanfei and Vandewiele, Gilles and Tinti, Michele and Steenwinckel, Bram and Ito, Takuya and Noumi, Taiga and He, Shujun and Ishi, Keiichiro and Lee, Youhan and {\"O}zt{\"u}rk, Fatih and Chiu, Anthony and {\"O}zt{\"u}rk, Emin and Amer, Karim and Fares, Mohamed and Participants, Eterna and Das, Rhiju},
  journal = {ArXiv},
  month   = oct,
  title   = {Deep learning models for predicting {RNA} degradation via dual crowdsourcing},
  year    = 2021
}
Downloads last month
20