Instructions to use multimolecule/deepsea with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- MultiMolecule
How to use multimolecule/deepsea with MultiMolecule:
pip install multimolecule
from multimolecule import AutoModel, AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/deepsea") model = AutoModel.from_pretrained("multimolecule/deepsea") inputs = tokenizer("ACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGG", return_tensors="pt") outputs = model(**inputs) embeddings = outputs.last_hidden_state - Notebooks
- Google Colab
- Kaggle
Fix README author attribution
Browse files
README.md
CHANGED
|
@@ -81,7 +81,7 @@ Deep convolutional neural network that predicts noncoding chromatin features (DN
|
|
| 81 |
|
| 82 |
## Disclaimer
|
| 83 |
|
| 84 |
-
This is an UNOFFICIAL implementation of [Predicting effects of noncoding variants with deep learning-based sequence model](https://doi.org/10.1038/nmeth.3547) by Jian Zhou
|
| 85 |
|
| 86 |
The OFFICIAL repository of DeepSEA is at [jisraeli/DeepSEA](http://deepsea.princeton.edu).
|
| 87 |
|
|
|
|
| 81 |
|
| 82 |
## Disclaimer
|
| 83 |
|
| 84 |
+
This is an UNOFFICIAL implementation of [Predicting effects of noncoding variants with deep learning-based sequence model](https://doi.org/10.1038/nmeth.3547) by Jian Zhou, et al.
|
| 85 |
|
| 86 |
The OFFICIAL repository of DeepSEA is at [jisraeli/DeepSEA](http://deepsea.princeton.edu).
|
| 87 |
|