Instructions to use multimolecule/hal with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- MultiMolecule
How to use multimolecule/hal with MultiMolecule:
pip install multimolecule
from multimolecule import AutoModel, AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/hal") model = AutoModel.from_pretrained("multimolecule/hal") inputs = tokenizer("UAGCUUAUCAGACUGAUGUUGA", return_tensors="pt") outputs = model(**inputs) embeddings = outputs.last_hidden_state - Notebooks
- Google Colab
- Kaggle
File size: 16,746 Bytes
8d9a34e | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 | ---
library_name: multimolecule
license: agpl-3.0
pipeline: splice-variant-effect
pipeline_tag: other
tags:
- Biology
- RNA
- Splicing
- rna
widget:
- example_title: microRNA 21
pipeline_tag: splice-variant-effect
sequence_type: ncRNA
task: splice-variant-effect
text: UAGCUUAUCAGACUGAUGUUGA
- example_title: microRNA 146a
pipeline_tag: splice-variant-effect
sequence_type: ncRNA
task: splice-variant-effect
text: UGAGAACUGAAUUCCAUGGGUU
- example_title: microRNA 155
pipeline_tag: splice-variant-effect
sequence_type: ncRNA
task: splice-variant-effect
text: UUAAUGCUAAUCGUGAUAGGGGUU
- example_title: RNA component of mitochondrial RNA processing endoribonuclease
pipeline_tag: splice-variant-effect
sequence_type: ncRNA
task: splice-variant-effect
text: GGUUCGUGCUGAAGGCCUGUAUCCUAGGCUACACACUGAGGACUCUGUUCCUCCCCUUUCCGCCUAGGGGAAAGUCCCCGGACCUCGGGCAGAGAGUGCCACGUGCAUACGCACGUAGACAUUCCCCGCUUCCCACUCCAAAGUCCGCCAAGAAGCGUAUCCCGCUGAGCGGCGUGGCGCGGGGGCGUCAUCCGUCAGCUCCCUCUAGUUACGCAGGCAGUGCGUGUCCGCGCACCAACCACACGGGGCUCAUUCUCAGCGCGGCUGUAAAAAAAAA
- example_title: 7SK small nuclear RNA
pipeline_tag: splice-variant-effect
sequence_type: ncRNA
task: splice-variant-effect
text: GGAUGUGAGGGCGAUCUGGCUGCGACAUCUGUCACCCCAUUGAUCGCCAGGGUUGAUUCGGCUGAUCUGGCUGGCUAGGCGGGUGUCCCCUUCCUCCCUCACCGCUCCAUGUGCGUCCCUCCCGAAGCUGCGCGCUCGGUCGAAGAGGACGACCAUCCCCGAUAGAGGAGGACCGGUCUUCGGUCAAGGGUAUACGAGUAGCUGCGCUCCCCUGCUAGAACCUCCAAACAAGCUCUCAAGGUCCAUUUGUAGGAGAACGUAGGGUAGUCAAGCUUCCAAGACUCCAGACACAUCCAAAUGAGGCGCUGCAUGUGGCAGUCUGCCUUUCUUUU
- example_title: telomerase RNA component
pipeline_tag: splice-variant-effect
sequence_type: ncRNA
task: splice-variant-effect
text: GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUUUUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCCGCGCGCUGUUUUUCUCGCUGACUUUCAGCGGGCGGAAAAGCCUCGGCCUGCCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCUGCUGGCCCGUUCGCCCCUCCCGGGGACCUGCGGCGGGUCGCCUGCCCAGCCCCCGAACCCCGCCUGGAGGCCGCGGUCGGCCCGGGGCUUCUCCGGAGGCACCCACUGCCACCGCGAAGAGUUGGGCUCUGUCAGCCGCGGGUCUCUCGGGGGCGAGGGCGAGGUUCAGGCCUUUCAGGCCGCAGGAAGAGGAACGGAGCGAGUCCCCGCGCGCGGCGCGAUUCCCUGAGCUGUGGGACGUGCACCCAGGACUCGGCUCACACAUGC
- example_title: vault RNA 2-1
pipeline_tag: splice-variant-effect
sequence_type: ncRNA
task: splice-variant-effect
text: CGGGUCGGAGUUAGCUCAAGCGGUUACCUCCUCAUGCCGGACUUUCUAUCUGUCCAUCUCUGUGCUGGGGUUCGAGACCCGCGGGUGCUUACUGACCCUUUUAUGCAA
- example_title: brain cytoplasmic RNA 1
pipeline_tag: splice-variant-effect
sequence_type: ncRNA
task: splice-variant-effect
text: GGCCGGGCGCGGUGGCUCACGCCUGUAAUCCCAGCUCUCAGGGAGGCUAAGAGGCGGGAGGAUAGCUUGAGCCCAGGAGUUCGAGACCUGCCUGGGCAAUAUAGCGAGACCCCGUUCUCCAGAAAAAGGAAAAAAAAAAACAAAAGACAAAAAAAAAAUAAGCGUAACUUCCCUCAAAGCAACAACCCCCCCCCCCCUUU
- example_title: HIV-1 TAR-WT
pipeline_tag: splice-variant-effect
sequence_type: ncRNA
task: splice-variant-effect
text: GGUCUCUCUGGUUAGACCAGAUCUGAGCCUGGGAGCUCUCUGGCUAACUAGGGAACC
- example_title: prion protein (Kanno blood group)
pipeline_tag: splice-variant-effect
sequence_type: mRNA
task: splice-variant-effect
text: AUGGCGAACCUUGGCUGCUGGAUGCUGGUUCUCUUUGUGGCCACAUGGAGUGACCUGGGCCUCUGC
- example_title: interleukin 10
pipeline_tag: splice-variant-effect
sequence_type: mRNA
task: splice-variant-effect
text: AUGCACAGCUCAGCACUGCUCUGUUGCCUGGUCCUCCUGACUGGGGUGAGGGCC
- example_title: Zaire ebolavirus
pipeline_tag: splice-variant-effect
sequence_type: mRNA
task: splice-variant-effect
text: AAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUCACAGAGCGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGUAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAU
- example_title: SARS coronavirus
pipeline_tag: splice-variant-effect
sequence_type: mRNA
task: splice-variant-effect
text: AUGUUUAUUUUCUUAUUAUUUCUUACUCUCACUAGUGGUAGUGACCUUGACCGGUGCACCACUUUUGAUGAUGUUCAAGCUCCUAAUUACACUCAACAUACUUCAUCUAUGAGGGGGGUUUACUAUCCUGAUGAAAUUUUUAGAUCAGACACUCUUUAUUUAACUCAGGAUUUAUUUCUUCCAUUUUAUUCUAAUGUUACAGGGUUUCAUACUAUUAAUCAUACGUUUGACAACCCUGUCAUACCUUUUAAGGAUGGUAUUUAUUUUGCUGCCACAGAGAAAUCAAAUGUUGUCCGUGGUUGGGUUUUUGGUUCUACCAUGAACAACAAGUCACAGUCGGUGAUUAUUAUUAACAAUUCUACUAAUGUUGUUAUACGAGCAUGUAACUUUGAAUUGUGUGACAACCCUUUCUUUGCUGUUUCUAAACCCAUGGGUACACAGACACAUACUAUGAUAUUCGAUAAUGCAUUUAAAUGCACUUUCGAGUACAUAUCU
- example_title: insulin
pipeline_tag: splice-variant-effect
sequence_type: mRNA
task: splice-variant-effect
text: AUGGCCCUGUGGAUGCGCCUCCUGCCCCUGCUGGCGCUGCUGGCCCUCUGGGGACCUGACCCAGCCGCAGCCUUUGUGAACCAACACCUGUGCGGCUCACACCUGGUGGAAGCUCUCUACCUAGUGUGCGGGGAACGAGGCUUCUUCUACACACCCAAGACCCGCCGGGAGGCAGAGGACCUGCAGGUGGGGCAGGUGGAGCUGGGCGGGGGCCCUGGUGCAGGCAGCCUGCAGCCCUUGGCCCUGGAGGGGUCCCUGCAGAAGCGUGGCAUUGUGGAACAAUGCUGUACCAGCAUCUGCUCCCUCUACCAGCUGGAGAACUACUGCAACUAG
- example_title: cyclin dependent kinase inhibitor 2A
pipeline_tag: splice-variant-effect
sequence_type: mRNA
task: splice-variant-effect
text: AUGGAGCCGGCGGCGGGGAGCAGCAUGGAGCCUUCGGCUGACUGGCUGGCCACGGCCGCGGCCCGGGGUCGGGUAGAGGAGGUGCGGGCGCUGCUGGAGGCGGGGGCGCUGCCCAACGCACCGAAUAGUUACGGUCGGAGGCCGAUCCAGGUCAUGAUGAUGGGCAGCGCCCGAGUGGCGGAGCUGCUGCUGCUCCACGGCGCGGAGCCCAACUGCGCCGACCCCGCCACUCUCACCCGACCCGUGCACGACGCUGCCCGGGAGGGCUUCCUGGACACGCUGGUGGUGCUGCACCGGGCCGGGGCGCGGCUGGACGUGCGCGAUGCCUGGGGCCGUCUGCCCGUGGACCUGGCUGAGGAGCUGGGCCAUCGCGAUGUCGCACGGUACCUGCGCGCGGCUGCGGGGGGCACCAGAGGCAGUAACCAUGCCCGCAUAGAUGCCGCGGAAGGUCCCUCAGACAUCCCCGAUUGA
- example_title: human papillomavirus type 16 E6
pipeline_tag: splice-variant-effect
sequence_type: mRNA
task: splice-variant-effect
text: AUGCACCAAAAGAGAACUGCAAUGUUUCAGGACCCACAGGAGCGACCCAGAAAGUUACCACAGUUAUGCACAGAGCUGCAAACAACUAUACAUGAUAUAAUAUUAGAAUGUGUGUACUGCAAGCAACAGUUACUGCGACGUGAGGUAUAUGACUUUGCUUUUCGGGAUUUAUGCAUAGUAUAUAGAGAUGGGAAUCCAUAUGCUGUAUGUGAUAAAUGUUUAAAGUUUUAUUCUAAAAUUAGUGAGUAUAGACAUUAUUGUUAUAGUUUGUAUGGAACAACAUUAGAACAGCAAUACAACAAACCGUUGUGUGAUUUGUUAAUUAGGUGUAUUAACUGUCAAAAGCCACUGUGUCCUGAAGAAAAGCAAAGACAUCUGGACAAAAAGCAAAGAUUCCAUAAUAUAAGGGGUCGGUGGACCGGUCGAUGUAUGUCUUGUUGCAGAUCAUCAAGAACACGUAGAGAAACCCAGCUGUAA
- example_title: NRAS proto-oncogene
pipeline_tag: splice-variant-effect
sequence_type: 5' UTR
task: splice-variant-effect
text: GGGGCCGGAAGUGCCGCUCCUUGGUGGGGGCUGUUCAUGGCGGUUCCGGGGUCUCCAACAUUUUUCCCGGCUGUGGUCCUAAAUCUGUCCAAAGCAGAGGCAGUGGAGCUUGAGGUUCUUGCUGGUGUGAA
- example_title: amyloid beta precursor protein
pipeline_tag: splice-variant-effect
sequence_type: 5' UTR
task: splice-variant-effect
text: GUCAGUUUCCUCGGCAGCGGUAGGCGAGAGCACGCGGAGGAGCGUGCGCGGGGGCCCCGGGAGACGGCGGCGGUGGCGGCGCGGGCAGAGCAAGGACGCGGCGGAUCCCACUCGCACAGCAGCGCACUCGGUGCCCCGCGCAGGGUCGCG
- example_title: RUNX family transcription factor 1
pipeline_tag: splice-variant-effect
sequence_type: 5' UTR
task: splice-variant-effect
text: ACUUCUUUGGGCCUCAUAAACAACCACAGAACCACAAGUUGGGUAGCCUGGCAGUGUCAGAAGUCUGAACCCAGCAUAGUGGUCAGCAGGCAGGACGAAUCACACUGAAUGCAAACCACAGGGUUUCGCAGCGUGGUAAAAGAAAUCAUUGAGUCCCCCGCCUUCAGAAGAGGGUGCAUUUUCAGGAGGAAGCG
- example_title: fragile X messenger ribonucleoprotein 1
pipeline_tag: splice-variant-effect
sequence_type: 5' UTR
task: splice-variant-effect
text: CUCAGUCAGGCGCUCAGCUCCGUUUCGGUUUCACUUCCGGUGGAGGGCCGCCUCUGAGCGGGCGGCGGGCCGACGGCGAGCGCGGGCGGCGGCGGUGACGGAGGCGCCGCUGCCAGGGGGCGUGCGGCAGCGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCUGGGCCUCGAGCGCCCGCAGCCCACCUCUCGGGGGCGGGCUCCCGGCGCUAGCAGGGCUGAAGAGAAG
- example_title: MYC proto-oncogene
pipeline_tag: splice-variant-effect
sequence_type: 5' UTR
task: splice-variant-effect
text: AACUCGCUGUAGUAAUUCCAGCGAGAGGCAGAGGGAGCGAGCGGGCGGCCGGCUAGGGUGGAAGAGCCGGGCGAGCAGAGCUGCGCUGCGGGCGUCCUGGGAAGGGAGAUCCGGAGCGAAUAGGGGGCUUCGCCUCUGGCCCAGCCCUCCCGCUGAUCCCCCAGCCAGCGGUCCGCAACCCUUGCCGCAUCCACGAAACUUUGCCCAUAGCAGCGGGCGGGCACUUUGCACUGGAACUUACAACACCCGAGCAAGGACGCGACUCUCCCGACGCGGGGAGGCUAUUCUGCCCAUUUGGGGACACUUCCCCGCCGCUGCCAGGACCCGCUUCUCUGAAAGGCUCUCCUUGCAGCUGCUUAGACG
- example_title: activating transcription factor 4
pipeline_tag: splice-variant-effect
sequence_type: 5' UTR
task: splice-variant-effect
text: CAUUUCUACUUUGCCCGCCCACAGAUGUAGUUUUCUCUGCGCGUGUGCGUUUUCCCUCCUCCCCGCCCUCAGGGUCCACGGCCACCAUGGCGUAUUAGGGGCAGCAGUGCCUGCGGCAGCAUUGGCCUUUGCAGCGGCGGCAGCAGCACCAGGCUCUGCAGCGGCAACCCCCAGCGGCUUAAGCCAUGGCGCUUCUCACGGCAUUCAGCAGCAGCGUUGCUGUAACCGACAAAGACACCUUCGAAUUAAGCACAUUCCUCGAUUCCAGCAAAGCACCGCAAC
- example_title: Human GPI protein p137
pipeline_tag: splice-variant-effect
sequence_type: 3' UTR
task: splice-variant-effect
text: UUUUUAAAAGGAAAAGAUACCAAAUGCCUGCUGCUACCACCCUUUUCAAUUGCUAUGUUUUGAAAGGCACCAGUAUGUGUUUUAGAUUGAUUUAAAUGUUUCAUUUAAAUCACGGACAGUAGUUUCAGUUCUGAUGGUAUAAGCAAAACAAAUAAAACGUUUAUAAAAGUUGUAUCUUGAAACACUGGUGUUCAACAGCUAGCAGCUUAUGUGAUUCACCCCAUGCCACGUUAGUGUCACAAAUUUUAUGGUUUAUCUCCAGCAACAUUUCUCUAGUACUUGCACUUAUUAUCUGAAUUC
- example_title: nucleophosmin 1
pipeline_tag: splice-variant-effect
sequence_type: 3' UTR
task: splice-variant-effect
text: GAAAAUAGUUUAAACAAUUUGUUAAAAAAUUUUCCGUCUUAUUUCAUUUCUGUAACAGUUGAUAUCUGGCUGUCCUUUUUAUAAUGCAGAGUGAGAACUUUCCCUACCGUGUUUGAUAAAUGUUGUCCAGGUUCUAUUGCCAAGAAUGUGUUGUCCAAAAUGCCUGUUUAGUUUUUAAAGAUGGAACUCCACCCUUUGCUUGGUUUUAAGUAUGUAUGGAAUGUUAUGAUAGGACAUAGUAGUAGCGGUGGUCAGACAUGGAAAUGGUGGGGAGACAAAAAUAUACAUGUGAAAUAAAACUCAGUAUUUUAAUAAAGUAGCACGGUUUCUAUUGA
- example_title: superoxide dismutase 1
pipeline_tag: splice-variant-effect
sequence_type: 3' UTR
task: splice-variant-effect
text: ACAUUCCCUUGGAUGUAGUCUGAGGCCCCUUAACUCAUCUGUUAUCCUGCUAGCUGUAGAAAUGUAUCCUGAUAAACAUUAAACACUGUAAUCUUAAAAGUGUAAUUGUGUGACUUUUUCAGAGUUGCUUUAAAGUACCUGUAGUGAGAAACUGAUUUAUGAUCACUUGGAAGAUUUGUAUAGUUUUAUAAAACUCAGUUAAAAUGUCUGUUUCAAUGACCUGUAUUUUGCCAGACUUAAAUCACAGAUGGGUAUUAAACUUGUCAGAAUUUCUUUGUCAUUCAAGCCUGUGAAUAAAAACCCUGUAUGGCACUUAUUAUGAGGCUAUUAAAAGAAUCCAAAUUCAAACUAAA
- example_title: hemoglobin subunit alpha 2
pipeline_tag: splice-variant-effect
sequence_type: 3' UTR
task: splice-variant-effect
text: CUGGAGCCUCGGUAGCCGUUCCUCCUGCCCGCUGGGCCUCCCAACGGGCCCUCCUCCCCUCCUUGCACCGGCCCUUCCUGGUCUUUGAAUAAAGUCUGAGUGGGCAGCA
- example_title: BRAF proto-oncogene
pipeline_tag: splice-variant-effect
sequence_type: 3' UTR
task: splice-variant-effect
text: AACAAAUGAGUGAGAGAGUUCAGGAGAGUAGCAACAAAAGGAAAAUAAAUGAACAUAUGUUUGCUUAUAUGUUAAAUUGAAUAAAAUACUCUCUUUUUUUUUAAGGUGAACCAAAGAACACUUGUGUGGUUAAAGACUAGAUAUAAUUUUUCCCCAAACUAAAAUUUAUACUUAACAUUGGAUUUUUAACAUCCAAGGGUUAAAAUACAUAGACAUUGCUAAAAAUUGGCAGAGCCUCUUCUAGAGGCUUUACUUUCUGUUCCGGGUUUGUAUCAUUCACUUGGUUAUUUUAAGUAGUAAACUUCAGUUUCUCAUGCAACUUUUGUUGCCAGCUAUCACAUGUCCACUAGGGACUCCAGAAGAAGACCCUACCUAUGCCUGUGUUUGCAGGUGAGAAGUUGGCAGUCGGUUAGCCUGGG
- example_title: H3 clustered histone 1
pipeline_tag: splice-variant-effect
sequence_type: 3' UTR
task: splice-variant-effect
text: UUACUGUGGUCUCUCUGACGGUCCAAGCAAAGGCUCUUUUCAGAGCCACCACCUUUUC
---
# HAL
Hexamer Additive Linear model for predicting alternative splicing from sequence.
## Disclaimer
This is an UNOFFICIAL implementation of [Learning the Sequence Determinants of Alternative Splicing from Millions of Random Sequences](https://doi.org/10.1016/j.cell.2015.09.054) by Alexander B. Rosenberg, et al.
The OFFICIAL repository of HAL is at [Alex-Rosenberg/cell-2015](https://github.com/Alex-Rosenberg/cell-2015).
> [!TIP]
> The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
**The team releasing HAL did not write this model card for this model so this model card has been written by the MultiMolecule team.**
## Model Details
HAL is a linear (additive) model that scores alternative 5' splice-site usage from normalized hexamer (6-mer) frequencies across a 160-nucleotide donor-region window. It was learned from massively parallel reporter assays measuring splicing of millions of random synthetic sequences. The published coefficient table contains a `(4096, 8)` matrix of hexamer effects; the model averages the eight coefficient columns into one effect per hexamer and applies those effects to normalized hexamer frequencies.
### Model Specification
| Window | Published Coefficient Columns | Hexamer Features | Num Parameters (M) | FLOPs | MACs |
| ------ | ----------------------------- | ---------------- | ------------------ | ----- | ----- |
| 160 nt | 8 averaged | 4,096 | 0.004 | 8,192 | 4,096 |
### Links
- **Code**: [multimolecule.hal](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/hal)
- **Data**: Rosenberg lab random-library 5' splice-site MPRA
- **Paper**: [Learning the Sequence Determinants of Alternative Splicing from Millions of Random Sequences](https://doi.org/10.1016/j.cell.2015.09.054)
- **Developed by**: Alexander B. Rosenberg, Rupali P. Patwardhan, Jay Shendure, Georg Seelig
- **Model type**: Linear regression over normalized hexamer-frequency features with learned per-hexamer effect coefficients
- **Original Repository**: [Alex-Rosenberg/cell-2015](https://github.com/Alex-Rosenberg/cell-2015)
## Usage
The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip:
```bash
pip install multimolecule
```
### Direct Use
#### Alternative Splicing Prediction
You can use this model directly to predict a splicing score for a 160-nucleotide RNA sequence window:
```python
>>> import torch
>>> from multimolecule import RnaTokenizer, HalForSequencePrediction
>>> tokenizer = RnaTokenizer.from_pretrained("multimolecule/hal")
>>> model = HalForSequencePrediction.from_pretrained("multimolecule/hal")
>>> sequence = "ACGU" * 40
>>> input = tokenizer(sequence, add_special_tokens=False, return_tensors="pt")
>>> output = model(**input)
>>> output.logits.shape
torch.Size([1, 1])
```
### Interface
- **Input length**: 160 nt fixed donor-region window
- **Alphabet**: `ACGU` only; any hexamer spanning an unknown / `N` token is ignored
- **Special tokens**: do not add (`add_special_tokens=False`)
- **Output**: single scalar splicing score per window
- **Variant effect**: subtract two window scores and apply sigmoid externally for paired donor comparisons
## Training Details
HAL was learned from massively parallel splicing reporter assays in which millions of random synthetic sequences were inserted into an alternatively spliced reporter minigene. Splicing outcomes were measured by high-throughput sequencing of the resulting mRNA isoforms.
### Training Data
The model was trained on the splicing measurements of millions of degenerate (random) sequences from the reporter library described in the HAL paper. Hexamer coefficients were estimated by regressing the measured splicing index against the hexamer composition of each sequence.
### Training Procedure
#### Pre-training
HAL is a linear regression model. The published hexamer coefficient table is fit to the measured splicing index, and the model prediction is the linear combination of normalized hexamer frequencies with the averaged hexamer effects.
The HAL model uses the published `HAL_mer_scores.npz` hexamer coefficient table from Rosenberg et al. The table stores 4,096 hexamer rows and eight coefficient columns; the eight columns are averaged into the single per-hexamer effect used by the HAL formula.
## Citation
```bibtex
@article{rosenberg2015learning,
author = {Rosenberg, Alexander B. and Patwardhan, Rupali P. and Shendure, Jay and Seelig, Georg},
journal = {Cell},
number = 3,
pages = {698--711},
publisher = {Elsevier BV},
title = {Learning the Sequence Determinants of Alternative Splicing from Millions of Random Sequences},
volume = 163,
year = 2015,
doi = {10.1016/j.cell.2015.09.054}
}
```
> [!NOTE]
> The artifacts distributed in this repository are part of the MultiMolecule project.
> If MultiMolecule supports your research, please cite the MultiMolecule project as follows:
```bibtex
@software{chen_2024_12638419,
author = {Chen, Zhiyuan and Zhu, Sophia Y.},
title = {MultiMolecule},
doi = {10.5281/zenodo.12638419},
publisher = {Zenodo},
url = {https://doi.org/10.5281/zenodo.12638419},
year = 2024,
month = may,
day = 4
}
```
## Contact
Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card.
Please contact the authors of the [HAL paper](https://doi.org/10.1016/j.cell.2015.09.054) for questions or comments on the paper/model.
## License
This model implementation is licensed under the [GNU Affero General Public License](license.md).
For additional terms and clarifications, please refer to our [License FAQ](license-faq.md).
```spdx
SPDX-License-Identifier: AGPL-3.0-or-later
``` |